ID: 1182630058

View in Genome Browser
Species Human (GRCh38)
Location 22:31678199-31678221
Sequence CTGTGGATAAGGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 693}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182630052_1182630058 7 Left 1182630052 22:31678169-31678191 CCTCAGTGAAATGCGAAGGAAAA 0: 1
1: 0
2: 0
3: 42
4: 365
Right 1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG 0: 1
1: 0
2: 9
3: 65
4: 693
1182630051_1182630058 10 Left 1182630051 22:31678166-31678188 CCTCCTCAGTGAAATGCGAAGGA 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG 0: 1
1: 0
2: 9
3: 65
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182630058 Original CRISPR CTGTGGATAAGGAAGGAGGA GGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
900946852 1:5835674-5835696 CAGTGGTTGAGGCAGGAGGATGG - Intergenic
901267589 1:7923485-7923507 CTCTAGGGAAGGAAGGAGGATGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902156048 1:14487419-14487441 CTGGGGATGAGAAAGGAGGTGGG - Intergenic
902652975 1:17848700-17848722 CTCTGGAGAAGGAAGCAGGGGGG - Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903695145 1:25200957-25200979 GGGAGGATAAGGCAGGAGGATGG - Intergenic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
906156620 1:43617713-43617735 CTATGGATAAGAAAGGAGGTGGG - Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907848153 1:58228545-58228567 GTGTGGATATGGCAGGGGGAGGG + Intronic
908027921 1:59970992-59971014 ATTTGCATAAGGCAGGAGGATGG + Intergenic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909929376 1:81477925-81477947 GTGTGGCTCAGGAAGGAAGAGGG + Intronic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914343731 1:146780880-146780902 CTTTTGATGAGGAAGCAGGAAGG - Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915029124 1:152861058-152861080 AGGAGGAGAAGGAAGGAGGAGGG - Intergenic
915395889 1:155583803-155583825 CTGTGGACTAGGAAGCAGGCTGG - Intergenic
915411495 1:155704414-155704436 CTGTGGACTAGGAAGCAGGCTGG - Intronic
915467125 1:156104317-156104339 CAGTTGCTAAGCAAGGAGGAAGG - Intronic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916157997 1:161877204-161877226 CTGAGGATATGCAAGGAGCATGG + Intronic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917835101 1:178935359-178935381 CTGTCTCTAAGGAAGTAGGATGG + Intergenic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
919856974 1:201712674-201712696 CTTTGGGAAAGGGAGGAGGAAGG + Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920916593 1:210262574-210262596 ATGAGGAGAAGGAAGGAGGGAGG - Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922599251 1:226837140-226837162 CTGTGTGTAAGGAAAAAGGATGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063251102 10:4275951-4275973 CTGTGGATAAGGCAGGACTATGG + Intergenic
1063374983 10:5548880-5548902 GTGTGGATAAGGGAGAGGGAGGG - Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1065927736 10:30450639-30450661 CTCTGGAGAAGGAAGACGGACGG - Intronic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1067023989 10:42827594-42827616 GTGGGGATAAGGAAGCAAGAGGG - Intronic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068677898 10:59786916-59786938 CTGAGGCTAAGGCAGGACGAAGG + Intergenic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069685162 10:70313218-70313240 GAGTGCAGAAGGAAGGAGGAGGG - Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1069937974 10:71932064-71932086 CTGTTGATAAAGCAGCAGGAGGG - Intergenic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070368664 10:75760689-75760711 GGGTGGATAGGGAAGGATGAGGG + Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1073293881 10:102426734-102426756 CGGAGGCTAAGGCAGGAGGATGG - Intronic
1073296098 10:102439745-102439767 CTGAGGCTAAGGCAGGAGAATGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073730452 10:106281373-106281395 CTGTTGCCATGGAAGGAGGACGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074271618 10:111959234-111959256 CTTTGGAGAATGAAGGAAGAGGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1075551965 10:123399641-123399663 CTGTGCATCAGGAAGGGCGAAGG - Intergenic
1075578291 10:123596870-123596892 CTGTGCCTAAGAATGGAGGAGGG + Intergenic
1076675125 10:132143730-132143752 CTCAGGATAAGGAAGGGGGCAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076854305 10:133108420-133108442 CCGTGGAGAAGGAAGCAGGGAGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077881093 11:6350966-6350988 CAGTTGATCAGGAAGCAGGATGG + Intergenic
1078436572 11:11330483-11330505 CCGTGGAGAAGGCAGGAGGGAGG + Intronic
1078851598 11:15169139-15169161 AGGTGGTTAAGGAAGGAGCAGGG + Intronic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079696553 11:23489000-23489022 CTGTGTATAAGGTATAAGGAAGG - Intergenic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1084301192 11:68253796-68253818 GGGAGGATAAGGCAGGAGGATGG - Intergenic
1084306477 11:68287931-68287953 GGGTGGATCAGGAAGGAGGGAGG - Intergenic
1084585702 11:70060833-70060855 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085566156 11:77515606-77515628 CTTTGGATAAGGAATGAGTCAGG - Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1087197012 11:95312343-95312365 CTTTGGATTAGGAAGAAGGGCGG - Intergenic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088256669 11:107909722-107909744 AGGTGGATAAGGAAGGAGGTGGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088329465 11:108635363-108635385 AGGTGGACAAGGAAGTAGGAGGG - Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092278001 12:7076802-7076824 CTGAGGATCAGGGAGGAGAAAGG - Intergenic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093432414 12:19098937-19098959 GTGGGGCTAAGGCAGGAGGATGG - Intergenic
1093674910 12:21927329-21927351 ATGTGGATAAGGAAGTTGGTTGG + Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096135746 12:49198964-49198986 CTTTGGAGAAGGAAGGGGGCAGG - Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096168910 12:49450352-49450374 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1096183438 12:49563822-49563844 CTTTGGCCAAGTAAGGAGGAAGG - Intronic
1096546182 12:52341643-52341665 CTGTGGCTTAGGAAGGGGAAAGG + Intergenic
1096670530 12:53195843-53195865 CTATGGAATAGGAAGGAGGTAGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100145904 12:91677135-91677157 CTCTTCATAAGGCAGGAGGAAGG - Intergenic
1100409573 12:94301942-94301964 ATAAGGCTAAGGAAGGAGGAGGG - Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1101838261 12:108310222-108310244 ATGTGGCTAAGGAAAGAAGAGGG + Intronic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102242998 12:111337068-111337090 GGGAGGATAAGGCAGGAGGATGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104649190 12:130519300-130519322 CTGTGGCTAAGAAAAAAGGAAGG - Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105931752 13:25059151-25059173 CTGTGTTTAAGGGAGAAGGATGG + Intergenic
1106166010 13:27246970-27246992 CAGTGGCTGAGGCAGGAGGATGG + Intergenic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108147522 13:47495262-47495284 AAGTGGATTAGGAAGGATGAAGG + Intergenic
1109036924 13:57274980-57275002 TTATGGCTAGGGAAGGAGGATGG - Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109326473 13:60873309-60873331 GTGTGGATAGGGAAAGAGGTTGG + Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112494316 13:99893592-99893614 CTTTGGATTAGGCTGGAGGATGG - Exonic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113600141 13:111562871-111562893 CTGTGGAGAAGTTAGGAGAAGGG + Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114498840 14:23153380-23153402 CTGTGTATAATGAAGGAAGGCGG - Intronic
1114741524 14:25103278-25103300 ATATATATAAGGAAGGAGGAAGG + Intergenic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1115993055 14:39169596-39169618 CTGAGCATTAGGAATGAGGAAGG + Intronic
1117839640 14:59846287-59846309 CTGTAGGTGAGCAAGGAGGAGGG - Intronic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118536388 14:66771063-66771085 CAGTGGCTTAGGAAGGATGAAGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120401837 14:84042105-84042127 CTTTGGAGAAGGAAGGAGAGGGG + Intergenic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1122041101 14:98988026-98988048 CTTTGGATTAGGAAGAAGGGTGG - Intergenic
1122293733 14:100693606-100693628 CCATGGAGAGGGAAGGAGGAAGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1124058541 15:26265231-26265253 CAGCGGGTAAGGGAGGAGGAAGG - Intergenic
1124480047 15:30070591-30070613 CTCTTGAGAAGGAAGGAGGTTGG + Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1125411614 15:39411925-39411947 CTGATGGTAAGGTAGGAGGAAGG + Intergenic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125667306 15:41441524-41441546 CTTTGGCTAAAAAAGGAGGAAGG - Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127729828 15:61789547-61789569 CTTTATATAAGGAAGGAGGCAGG - Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128286719 15:66443189-66443211 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129589916 15:76905630-76905652 GTGGTGATAAGGCAGGAGGAGGG - Intergenic
1129624971 15:77187617-77187639 CTGTTAATAATAAAGGAGGATGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1131684803 15:94757299-94757321 CTTTGGATTGGGAAGAAGGACGG - Intergenic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137026046 16:35475899-35475921 ATGAGGCTAAGGCAGGAGGATGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1139754509 16:69132189-69132211 GTGTGGAGACGGAAGGCGGAGGG - Intronic
1139990261 16:70934454-70934476 CTTTTGATGAGGAAGCAGGAAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142705836 17:1693665-1693687 TTCTGAATAAGGAAGGAGCATGG + Intergenic
1142751604 17:1991987-1992009 GTGTGTACAAGGAAGGAGGGTGG - Intronic
1143046591 17:4085700-4085722 CTGTCGATTAGGAAAGAAGATGG + Exonic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144082113 17:11772921-11772943 CTGTGAACAAGGCAAGAGGAAGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146489738 17:33271746-33271768 GTGTGGATAAGAATGGAGGCTGG - Intronic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148507550 17:48139913-48139935 CTCTCGGAAAGGAAGGAGGAGGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149291331 17:55220487-55220509 CAGTGGAAAAGTAAAGAGGAAGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149605245 17:57920053-57920075 CTGTGGATCAGGAATAAGAATGG - Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151416891 17:73972487-73972509 CAGTTGAGAAGGAAAGAGGAGGG + Intergenic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1155178458 18:23322225-23322247 TTGTGGTTTAGGGAGGAGGATGG + Intronic
1155416694 18:25606206-25606228 CTGTTGATAAGGAATGACGAGGG - Intergenic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1155918966 18:31584002-31584024 CTTTAGAGAAGGAAGGATGAGGG - Intergenic
1156015985 18:32547573-32547595 CTGTGGAGAAGAAAACAGGAGGG - Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1159002408 18:62986157-62986179 CTGTTCATAAGGAAGAAGTATGG - Intergenic
1159116848 18:64124147-64124169 GTGTGGATAAGTGAGGAGCAAGG - Intergenic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1160321878 18:77904151-77904173 CTGTGGGTAAGGTAGGAGTTTGG - Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1162617465 19:11813924-11813946 CCGTGCAGAAGGAAGGAGCAGGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1164212779 19:23114888-23114910 CTGTGACTAGGGCAGGAGGATGG - Intronic
1164259019 19:23553125-23553147 CTGTGTGTAAGGAAAAAGGATGG - Intronic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1165213461 19:34253490-34253512 GTGTGGAGAAGGAAGGACTACGG - Intergenic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166137039 19:40783898-40783920 CTGTGGAGAAGGGAGAAGGGAGG - Intronic
1166574202 19:43821638-43821660 CTGTAGATAGGGAATGAGTAGGG + Intronic
1166589121 19:43980542-43980564 CTGGTGAGAAGGAAGCAGGAAGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167477282 19:49708395-49708417 CGGAGGCTAAGGCAGGAGGATGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168615688 19:57835159-57835181 ATGGGGTTAAGGGAGGAGGAAGG + Intronic
1168621095 19:57880289-57880311 ATGGGGTTAAGGGAGGAGGAAGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926782340 2:16484875-16484897 ATTTGGATAAGCAAAGAGGAAGG + Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932098492 2:68874087-68874109 GGGTGGACAAGGAAGGAGGTTGG + Intergenic
932809561 2:74812850-74812872 GGGTGGCTAAGGTAGGAGGACGG + Intergenic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933146236 2:78856734-78856756 CAGTAGATAAGAAAGGCGGAAGG - Intergenic
934054543 2:88240839-88240861 TTGTGGAGAAGGAAGAGGGAAGG - Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
937469726 2:122164836-122164858 CTCTGGAGCAGGAAGCAGGAAGG + Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939111030 2:138007743-138007765 TTTTGGAGAAGGAAGGAGGTAGG - Intronic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
939830655 2:147066448-147066470 CTGAGGTTAAGGAAAGTGGAAGG - Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
940861851 2:158778877-158778899 CTGGGGATTAGGAAAGAGGTTGG + Intergenic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941492028 2:166154248-166154270 CTCTTGGTAAGGAAGAAGGAAGG + Intergenic
941719827 2:168801134-168801156 CTTTGGATAAGCAAAGAGGGAGG + Exonic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
945071070 2:205989485-205989507 CTGAGCATAAGGAATGTGGAAGG - Intergenic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
946160104 2:217830680-217830702 CTCTGAGGAAGGAAGGAGGATGG - Intronic
946375301 2:219304637-219304659 ATGTGAATAAGCAAGGAGGCAGG - Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
947418275 2:229920885-229920907 CTATGGAGAAGGAAGGAGAGGGG + Intronic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1169695231 20:8380135-8380157 TTTTGTATAAGGTAGGAGGAAGG + Intronic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173341962 20:42161059-42161081 CTTTGGATAATGAAAGGGGAAGG + Intronic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1173872716 20:46351868-46351890 CTGTGGTCAAGGCAGAAGGAGGG + Intronic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1174582524 20:51582174-51582196 CTCTGGATTAGGAATAAGGATGG - Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174978131 20:55358193-55358215 ATGTGGGTAATGAAGTAGGATGG - Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1177197421 21:17918087-17918109 CTGAGGATAAGGAAGGTGTTAGG + Intronic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181256253 22:21564755-21564777 CTGTGGAGAATTACGGAGGAAGG - Intronic
1181856952 22:25788712-25788734 AGGAGGAGAAGGAAGGAGGAGGG - Intronic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182126753 22:27821512-27821534 CTCTCGATAAGAAAGCAGGAGGG - Intergenic
1182250489 22:28996176-28996198 GGGAGGCTAAGGAAGGAGGATGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185173451 22:49306290-49306312 CTGGGGATTAGGCAGGAGGGAGG + Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949168872 3:974484-974506 CCGTGGATAAGGGAGGACTACGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949634723 3:5970074-5970096 CTAAGGATAAGGGAGGAGTAAGG + Intergenic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950692790 3:14673583-14673605 CTGTGGAGTAGAAAGGAGAAGGG + Intergenic
951186371 3:19718301-19718323 CTGTTGTCAAGGAAGCAGGATGG + Intergenic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
953234803 3:41096799-41096821 CTGTGGAGCAGTAAGGTGGAGGG - Intergenic
953840905 3:46389598-46389620 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
954139404 3:48597088-48597110 CTGTTGAGAAGGTAGGAGTAAGG + Intergenic
954264075 3:49459830-49459852 GAGTGAATAAGGAAAGAGGAGGG - Intergenic
954280354 3:49572872-49572894 GTGTGCAGAAGAAAGGAGGAAGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954685573 3:52368423-52368445 CAATGGACAAGGATGGAGGAGGG - Intronic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955724767 3:61921155-61921177 CTGTAGATAGGTAAGAAGGAAGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956619210 3:71203923-71203945 TCATGGAAAAGGAAGGAGGAAGG + Intronic
957116558 3:76034197-76034219 CTTTGAATAAGGCAGGAGCATGG + Intronic
957129730 3:76207735-76207757 ATGTGGATCACAAAGGAGGAAGG + Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959182647 3:103001655-103001677 CTGTATATAAGGCAGGCGGAGGG + Intergenic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961585522 3:127919063-127919085 CTGTGGATAGGACAGGAGCAGGG - Intronic
962536741 3:136335618-136335640 GTGAGGCTAAGGTAGGAGGATGG - Intronic
963291364 3:143493222-143493244 CTTTGCATAAGGAAGGAGCAGGG + Intronic
963510752 3:146245174-146245196 CTATGGATAAGGAAAGAAAATGG + Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964602832 3:158521358-158521380 CTGGGGATAAGGCAGGACAAGGG - Intronic
967890694 3:194362373-194362395 CTGTGGATAAGCATGGAACAAGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968581327 4:1396680-1396702 GTCTGCAGAAGGAAGGAGGAGGG + Intergenic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971394421 4:26215160-26215182 AGGAGGATAGGGAAGGAGGAAGG + Intronic
971510401 4:27417049-27417071 ATTTGGATAAGTAATGAGGAGGG + Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
974675223 4:65079791-65079813 CGGTGGCTAAGGCAGGAGAATGG - Intergenic
975081046 4:70280903-70280925 CTGTGCCTATGGAAAGAGGAAGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976988717 4:91336052-91336074 CTGCTGAGAAGAAAGGAGGAGGG + Intronic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977546686 4:98390705-98390727 CTATAGATAAGGAAGCAGGTGGG - Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979226147 4:118287248-118287270 GAGTGGCTAAGGCAGGAGGATGG - Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981941497 4:150286410-150286432 CAAAGGATGAGGAAGGAGGAAGG - Intronic
983123807 4:163923541-163923563 CTTAGGATAAGCAAGGAAGAAGG + Intronic
983205347 4:164905190-164905212 AGGAGGTTAAGGAAGGAGGATGG + Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984715283 4:182918832-182918854 CGGTGGATTTGGGAGGAGGAGGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985548790 5:523044-523066 CTGCGGAGAAGGGAGGAGGCGGG + Intronic
986407719 5:7443094-7443116 CTGTGGAAAAGGAAAGATGGAGG - Intronic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
987293622 5:16530992-16531014 GGGAGAATAAGGAAGGAGGAAGG + Intronic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988699341 5:33657907-33657929 CTCTGGATTAGAATGGAGGAAGG - Intronic
989579022 5:43014812-43014834 TTATGGTTAAGGAAGAAGGAAGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
992181931 5:74205912-74205934 CTGTGTATAAGCCAGGAAGAAGG + Intergenic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
994253322 5:97563085-97563107 ATATGGAGAAGGAAGAAGGAAGG + Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
994943551 5:106356428-106356450 CTTTGCATAAGGCAGCAGGAGGG + Intergenic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
996188350 5:120507953-120507975 CTGATGTTAAGGAAGAAGGAGGG - Intronic
996823939 5:127660289-127660311 CTCTGGACAAGGAAGGAGGCAGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998171919 5:139877527-139877549 CTGTGGATAAACAAGGAGCCTGG + Intronic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998511842 5:142720332-142720354 GTGGCGATAAGGCAGGAGGAAGG + Intergenic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001110268 5:168890033-168890055 CTGAGGCTAAGGCAGGAGAATGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002280857 5:178129448-178129470 GTGAGGGTTAGGAAGGAGGAGGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003334929 6:5161792-5161814 CTGAGGAGAAGGAAAGACGAAGG + Intronic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005957798 6:30676784-30676806 CTGTGGTCAAGGGAGGAGGCAGG + Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006527376 6:34618561-34618583 CCATGGAACAGGAAGGAGGAGGG - Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008138368 6:47803105-47803127 CTGTGGATAAAATAGAAGGAAGG + Intronic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1009641541 6:66343427-66343449 CTGCAGATAAGGAAGAAGTAAGG + Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011449321 6:87476042-87476064 CTGGGAATAAGGAAGTATGAGGG + Intronic
1012135666 6:95552782-95552804 CTATGGAGAAGGAATGAGGCAGG - Intergenic
1012270888 6:97209030-97209052 CCTGTGATAAGGAAGGAGGAGGG - Intronic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1013493842 6:110677952-110677974 CTGAAGCTAAGGCAGGAGGATGG - Intronic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016156752 6:140820160-140820182 GTTTGGATAAGGAAGAAGGGAGG + Intergenic
1016395164 6:143616736-143616758 ATTTGGATAAGGAATGAGGTTGG + Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1019920723 7:4161664-4161686 CCCTGGAGAAGGAAGGAGGCAGG + Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1023106916 7:36771642-36771664 GTGTGGCCAAGGAAGGAGGCTGG - Intergenic
1023209064 7:37783513-37783535 TTCTGGTTAAGAAAGGAGGATGG + Intronic
1023470714 7:40515200-40515222 CCGTGGATCAGGAATGAGGGTGG - Intronic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1023767694 7:43527214-43527236 TTCTGGACAAGCAAGGAGGAGGG + Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024586894 7:50849845-50849867 CTCAGGATGAGGAAGAAGGAGGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024819825 7:53315062-53315084 ATCTGGTTAAGTAAGGAGGACGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026008942 7:66621701-66621723 GTCAGGATAAGGAAGGAGGCTGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027333097 7:77120869-77120891 CGGTGGATAAGGGAGGACTACGG + Intergenic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029522615 7:101073236-101073258 GGGAGGCTAAGGAAGGAGGATGG + Intergenic
1029782692 7:102750432-102750454 CGGTGGATAAGGGAGGACTACGG - Intronic
1030443179 7:109614700-109614722 CTGTGGTTAAGGAATGAGTTGGG + Intergenic
1031574107 7:123394830-123394852 CTGTGGATAACAATGGAAGATGG + Intergenic
1031644372 7:124205380-124205402 ATTTGGATAAGGCATGAGGATGG + Intergenic
1031727083 7:125253255-125253277 CTGTGTATAAGCCAGGAAGAGGG + Intergenic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033025001 7:137763770-137763792 CTCTGGATGAGGAAGGTGTAAGG - Intronic
1033129014 7:138729597-138729619 GTGTGTATAAGAAAGGAGGCAGG - Intronic
1033360010 7:140632365-140632387 ATGTGGATAAGAAAGGTGGTGGG + Intronic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034817197 7:154182759-154182781 CTCTTGATGAGGAAGCAGGATGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035922146 8:3689217-3689239 CTGTGGATAAGTTAGAAGGTGGG - Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1037087878 8:14875463-14875485 CTTTGGATAAGGAAGGGACAAGG + Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038173906 8:25163700-25163722 CTGTTACTAAGGAAGGAGGGAGG + Intergenic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1039199135 8:35068284-35068306 GTATTGATAAGGAAGGAGCAGGG + Intergenic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039872257 8:41556452-41556474 GGGAGGATAAGGCAGGAGGATGG - Intergenic
1040420552 8:47236232-47236254 CAGTGGTTAAGGAAGAGGGAGGG + Intergenic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041292167 8:56318431-56318453 CTGTGGATCTGCAAGGATGAGGG + Intronic
1041506305 8:58601857-58601879 CTGCAGTTTAGGAAGGAGGAGGG - Intronic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1042803365 8:72745103-72745125 CTCTGGATCAGGGAGGTGGAGGG - Intronic
1044077813 8:87845330-87845352 CTGTCTATAAGTCAGGAGGATGG - Intergenic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1045280002 8:100741941-100741963 CTGAGGATAAGGTAGGTGGGTGG + Intergenic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045500172 8:102738697-102738719 CAGTGGAGAAGCAAGAAGGAGGG + Intergenic
1045737264 8:105310790-105310812 CAGTGGATAAGGAAACAGAATGG + Intronic
1045811631 8:106227509-106227531 CTATGGTTAATGAAGGAGGCAGG - Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046440109 8:114244165-114244187 CTTTGGATAGGGAAGAAGGGCGG - Intergenic
1046443344 8:114284813-114284835 CTTTGGATAGGGAAGAAGGGCGG - Intergenic
1047318899 8:123760494-123760516 CTGTAAATAAGGGAAGAGGATGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1049096571 8:140551733-140551755 CGGTGGATAAGGTAGGTGGGTGG + Intronic
1049479968 8:142817942-142817964 CGGTGGACCAGGCAGGAGGAGGG + Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051692428 9:19729707-19729729 GGCTGGATAGGGAAGGAGGAAGG + Intronic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055497092 9:76866740-76866762 AAGTGGGTAAGAAAGGAGGAAGG + Intronic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058011365 9:99981154-99981176 TTGTGAATAAGAAAGTAGGATGG - Exonic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058603827 9:106699572-106699594 CTGTGAATCACGAAGCAGGAGGG - Intergenic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1058793198 9:108471536-108471558 CTGAGGCTAAGGCAGGAGGATGG + Intergenic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1058968596 9:110059598-110059620 CTGTGGATGTGAAAGGAGGTGGG + Intronic
1059107340 9:111523138-111523160 CTGTGCATCAGGAAGGAAGCAGG - Intergenic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060006357 9:120003539-120003561 CTCTGGATTAGGAAGTGGGAAGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060294570 9:122334487-122334509 TTGTAGAGAAGGAAGGAGAAAGG + Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060810169 9:126607301-126607323 CTCTGGATAAGGCAGCAGGGTGG - Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062038969 9:134395558-134395580 CTCTGGAGGAGAAAGGAGGATGG - Intronic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186912367 X:14182314-14182336 CTGTGGATAGTGGAGGAGGGAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190000695 X:46683619-46683641 CTGTGAATAAGGAAGGAGTGTGG + Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190465933 X:50725113-50725135 ATGTGGCTAAGAAAAGAGGAAGG + Intronic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1194966441 X:100293752-100293774 ATTTGGATAGGGAAGAAGGATGG + Exonic
1195934630 X:110113051-110113073 TGGCGGAAAAGGAAGGAGGAAGG - Intronic
1196138256 X:112232966-112232988 CTGTTCATAAGGCAGTAGGAAGG + Intergenic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1198137941 X:133772964-133772986 CCTTGGAGAAGGAAAGAGGAAGG + Intronic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1200007548 X:153097831-153097853 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201638598 Y:16153760-16153782 TTGTGGATAAAGAAGAAGGCAGG - Intergenic