ID: 1182636727

View in Genome Browser
Species Human (GRCh38)
Location 22:31733613-31733635
Sequence CCTGTTCACCGAACACTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182636727_1182636731 28 Left 1182636727 22:31733613-31733635 CCTTAAAGTGTTCGGTGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1182636731 22:31733664-31733686 TGCCAAACTGCTCCTCAGAAAGG 0: 1
1: 1
2: 10
3: 67
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182636727 Original CRISPR CCTGTTCACCGAACACTTTA AGG (reversed) Intronic
902413347 1:16225153-16225175 CCTCTTCCCAGCACACTTTAAGG + Intergenic
903358992 1:22765286-22765308 CCTGTAATCCCAACACTTTAGGG + Intronic
906381350 1:45333843-45333865 CCTATTCACAAAACACTTTCAGG + Intronic
907177519 1:52538901-52538923 CCTGTAATCCCAACACTTTAGGG + Intronic
909818578 1:80028381-80028403 CCTTTTAACCGAACAGTATATGG + Intergenic
910122609 1:83807114-83807136 CTTGTTCACTGAACACTTTGAGG + Intergenic
916523430 1:165586778-165586800 CATGTTCATAAAACACTTTATGG - Intergenic
919360878 1:196592939-196592961 CCTGTTCCCCCCACATTTTATGG - Intronic
919692670 1:200541692-200541714 CCTGTACTCCCAACACTTTGGGG + Intergenic
920554853 1:206897304-206897326 CCTAGTCACCCATCACTTTAAGG - Intergenic
1065342238 10:24718311-24718333 CCTATTTACCGAACACTTTTGGG - Intronic
1069659875 10:70116613-70116635 CCTGCTCACCAAACGCTTTGCGG + Exonic
1072982839 10:100114071-100114093 CCTGTATACCCAGCACTTTAGGG - Intergenic
1079966860 11:26990665-26990687 CCTGTTATCCTAACACTTTGTGG + Intergenic
1083247777 11:61443011-61443033 CCTGTAATCCCAACACTTTAAGG - Intronic
1083607482 11:63987307-63987329 CATTCTCACCGAACACTTGAGGG + Intronic
1085136037 11:74089539-74089561 ACTGTTCACCTATAACTTTATGG - Intronic
1088414885 11:109577904-109577926 CCTGTACACCCAATAATTTATGG + Intergenic
1091417916 12:306231-306253 CCTGTAAACCTAACAATTTAGGG - Intronic
1095728657 12:45480235-45480257 ACTGTTCACTGAAAACTTTTAGG - Intergenic
1095747501 12:45675948-45675970 CCTGTAATCCCAACACTTTATGG + Intergenic
1107291199 13:38855856-38855878 CCTGTTCCCCTAAAACTCTATGG + Intronic
1107938361 13:45363596-45363618 CCTTTTCTCTGAAAACTTTAAGG + Intergenic
1109473826 13:62850687-62850709 GTTGTTTACTGAACACTTTAGGG - Intergenic
1109646256 13:65261996-65262018 CCCTTTCACCTAACACTTGAGGG + Intergenic
1111363437 13:87207740-87207762 GCACTTCACAGAACACTTTATGG - Intergenic
1117045730 14:51811315-51811337 CCTGTAATCCCAACACTTTAGGG + Intergenic
1118616390 14:67577140-67577162 CCTGTACACCCCACACTCTATGG + Intronic
1123987852 15:25660569-25660591 CCTGTGAACCGAACACTGTAAGG + Intergenic
1126045142 15:44632764-44632786 CCTGTAATCCTAACACTTTAGGG - Intronic
1126398225 15:48242136-48242158 TCTGTTCACTGAACAATGTAGGG - Intronic
1128908589 15:71491611-71491633 CCTGTAATCCCAACACTTTAGGG + Intronic
1129817005 15:78564467-78564489 ACTCTTCACAGAACGCTTTATGG - Intergenic
1134635991 16:15792307-15792329 CCTGTAATCCCAACACTTTAGGG - Intronic
1138114025 16:54345928-54345950 CCTGTAATCCCAACACTTTAGGG - Intergenic
1140505136 16:75466753-75466775 CCTGTAAACCCAACACTTTTGGG + Intergenic
1142771197 17:2098242-2098264 CCTGTAGTCCGAACACTTTGGGG - Intronic
1145983867 17:29031217-29031239 CCTGTAATCCCAACACTTTAGGG - Intronic
1146414189 17:32616577-32616599 CCTGTAATCCCAACACTTTAAGG - Intronic
1148038228 17:44685042-44685064 CCTGTAATCCCAACACTTTAGGG - Intronic
1150501034 17:65650950-65650972 CCTGTTCCCCAAAAACCTTATGG - Intronic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1158464275 18:57675962-57675984 CCTGTAATCCGAACACTTTAGGG - Intronic
1159306952 18:66655180-66655202 CCTTTTCACCCAGCACTCTAGGG + Intergenic
1160992857 19:1867309-1867331 CCTGTAACCCCAACACTTTAGGG + Intergenic
1162437227 19:10668595-10668617 CCTGTAATCCCAACACTTTAGGG - Intronic
1163568846 19:18068395-18068417 CCTGTCCACCTACCACTTTGGGG - Exonic
1164102898 19:22074608-22074630 CCTGTAAACCCAACACTTTGGGG - Intronic
1164421300 19:28095552-28095574 CCTGGTCACAGAGAACTTTACGG + Intergenic
927455492 2:23245586-23245608 CTCATTCACCTAACACTTTATGG + Intergenic
927980581 2:27372309-27372331 ACTGTTCACTGAACCCTTAAAGG - Intronic
928294152 2:30068322-30068344 CCTGTTCACCTAACATTAAATGG + Intergenic
929193612 2:39163113-39163135 CCTGTAAACCCAACACTTTGGGG - Intergenic
929220884 2:39463872-39463894 CCTGTAATCCCAACACTTTAGGG - Intergenic
929715993 2:44310149-44310171 CCTGTAATCCTAACACTTTAAGG - Intronic
930314265 2:49778701-49778723 CCAGTCCACTGAACACTCTAAGG - Intergenic
932719260 2:74125791-74125813 CCTGTAATCCCAACACTTTAGGG - Intergenic
937896284 2:126978970-126978992 CCTGTTCTCCCAACACTTACTGG - Intergenic
947699463 2:232220448-232220470 CCTGTAATCCCAACACTTTAGGG + Intronic
948438723 2:237971578-237971600 CCTGTAATCCCAACACTTTAGGG - Intronic
948500307 2:238388113-238388135 CCTGTTATCCCAACACTTTGTGG + Intronic
1171452041 20:25242768-25242790 CCTGTAATCCCAACACTTTAGGG + Intergenic
1171838619 20:30181463-30181485 CCTGTTATCCCAGCACTTTAGGG + Intergenic
1172432171 20:34901351-34901373 CCTGTAATCCCAACACTTTAGGG - Intronic
1173473593 20:43342112-43342134 CCTGTGATCCCAACACTTTAGGG - Intergenic
1174003762 20:47394068-47394090 CCTGTAATCCTAACACTTTAGGG - Intergenic
1179133026 21:38655875-38655897 CCTGTTCACCAAATAATTTGAGG - Intronic
1182636727 22:31733613-31733635 CCTGTTCACCGAACACTTTAAGG - Intronic
1182994004 22:34796265-34796287 CCTATTCACTGAACACTTTGAGG + Intergenic
1184090605 22:42291121-42291143 CCTCTTCTCTGAACATTTTAAGG + Intronic
1184237864 22:43194672-43194694 CCTGTTCCCCCAAAACTTAACGG + Intergenic
950777527 3:15363459-15363481 CCTGTAATCCCAACACTTTAAGG - Intergenic
952129809 3:30348072-30348094 ACTCTTCACCAAACACTTTGTGG - Intergenic
953449073 3:42991262-42991284 CCTGTAATCCCAACACTTTAGGG - Intronic
953781762 3:45877490-45877512 CCTGTAAACCCAACACTTTGGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
979631018 4:122903303-122903325 CATGTTCACCCTACACTTTTAGG - Intronic
980102871 4:128559095-128559117 CCTGTTCATGGAAAACTATATGG + Intergenic
984438514 4:179734910-179734932 CCTGTTATCCCAGCACTTTAGGG - Intergenic
985224691 4:187747567-187747589 CCAGTTCAACAAACAATTTATGG + Intergenic
985923644 5:2999031-2999053 CCTGTTCACCCCACACTACATGG - Intergenic
986331936 5:6723592-6723614 CTTGTTCACTGAACACTGTTAGG - Intronic
987825277 5:23023163-23023185 CCTGTAATCCCAACACTTTAGGG - Intergenic
988622859 5:32841470-32841492 CCTGTTATCCGAGCATTTTAGGG - Intergenic
992787815 5:80186394-80186416 CCTGTAATCCCAACACTTTAGGG - Intronic
993713682 5:91253236-91253258 CCTGTAATCCGAACACTTTAGGG + Intergenic
994372553 5:98983757-98983779 CCTGTAATCCCAACACTTTAAGG + Intergenic
1001448024 5:171801777-171801799 CCTGTAATCCCAACACTTTAGGG + Intergenic
1003961769 6:11215464-11215486 CCTGTTCATGGAACCATTTAAGG + Intronic
1004698715 6:18058500-18058522 CCTGTAAACCCAGCACTTTAGGG + Intergenic
1005687964 6:28273282-28273304 CCTGTAAACCCAACACTTTGGGG + Intronic
1006485088 6:34333110-34333132 CCTGTTCCCCTAACCCTGTAAGG + Intronic
1006909356 6:37554189-37554211 CCTGTAATCCCAACACTTTAGGG - Intergenic
1008059919 6:46985975-46985997 CCTGTAATCCCAACACTTTAGGG + Intergenic
1013121384 6:107144129-107144151 CCTGTGATCCCAACACTTTAGGG - Intergenic
1020672708 7:11137843-11137865 CCTGTAATCCCAACACTTTAGGG - Intronic
1029085698 7:98010067-98010089 CCTGTAATCCCAACACTTTAGGG + Intergenic
1029679276 7:102096879-102096901 ACAGTTCACGGGACACTTTATGG - Intronic
1030022660 7:105291213-105291235 CCTGTTCCCAGAGCACTTTCTGG + Intronic
1039071902 8:33656443-33656465 CCTGTACTCCCAGCACTTTAGGG - Intergenic
1040448370 8:47519516-47519538 CCTGTAATCCGAACACTTTTGGG + Intronic
1043959671 8:86402549-86402571 CCTGTAATCCCAACACTTTAGGG - Intronic
1046861101 8:119092645-119092667 CCTGTAATCCCAACACTTTAGGG + Intronic
1199615194 X:149650318-149650340 CCTGTTCACCGAGAACTTGGAGG + Intergenic