ID: 1182636877

View in Genome Browser
Species Human (GRCh38)
Location 22:31735099-31735121
Sequence GAATATACACTGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182636877 Original CRISPR GAATATACACTGGTGGAGCT GGG Intronic
905012510 1:34756964-34756986 GAGTGAAGACTGGTGGAGCTGGG - Intronic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
909669180 1:78168895-78168917 CAATACACAGTGGTGGAGCAGGG + Intergenic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
911279609 1:95906791-95906813 GAATTTAGACTGGTGGAGGTGGG + Intergenic
912837821 1:113011845-113011867 AAATATACACTGGCGGGGCGTGG + Intergenic
915103058 1:153514520-153514542 GAAGATACACTGGCTGGGCTTGG - Intergenic
918580302 1:186119230-186119252 GAAGATACACTTGTGTCGCTAGG + Exonic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
920153581 1:203929741-203929763 GAAGAGAGACTGGTGCAGCTGGG + Intergenic
923962057 1:239096848-239096870 GCAGATATACTGGTGGGGCTGGG - Intergenic
1066019985 10:31288785-31288807 GAATATACAGATGTGAAGCTCGG + Intergenic
1066214727 10:33275055-33275077 AAATATACAATGGTGGAGCTAGG + Intronic
1066646451 10:37615819-37615841 GAAAATAACCTGGTGCAGCTGGG - Intergenic
1071228068 10:83554652-83554674 GAGTACAGACTGGTGGAGGTGGG - Intergenic
1077043376 11:534294-534316 GAATATAAGCTGGTGGTGGTGGG - Exonic
1080059954 11:27946599-27946621 GAATTTTCCCTGGTGGAGGTGGG - Intergenic
1080635675 11:34121222-34121244 GAATATAGACTGGTGGAGTGAGG + Intronic
1085894110 11:80616778-80616800 GAATATAAAATGGTGGAGCTAGG - Intergenic
1087915403 11:103804156-103804178 GAATATACAGTTTTGGAGTTTGG + Intergenic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1088737683 11:112741311-112741333 GAATATATAGTAGTGGGGCTGGG - Intergenic
1090858473 11:130632120-130632142 GAGGATACACTGGTGGGGGTTGG - Intergenic
1097388582 12:58980993-58981015 GACTAGTCACTGGAGGAGCTAGG + Intergenic
1097965405 12:65573899-65573921 AAATATACACTGGAGGAATTGGG + Intergenic
1101977967 12:109378613-109378635 GAATATAAAATGGTGCAGGTCGG - Intronic
1102543904 12:113641222-113641244 GAATATTGACTCGGGGAGCTGGG - Intergenic
1110698835 13:78523433-78523455 GAATATTCACTGATGGACCAAGG - Intergenic
1111871873 13:93843531-93843553 GATTAAAAACTGGTGGACCTTGG + Intronic
1112498440 13:99923681-99923703 GAATGTAAAATGGTGCAGCTAGG + Intergenic
1114519785 14:23325893-23325915 GAATTTACACTGGAGCCGCTGGG - Exonic
1119944506 14:78678442-78678464 GAAAATATACTGGAGTAGCTGGG - Intronic
1122059802 14:99129412-99129434 GAATAGACGCTGGAGGAGCAGGG - Intergenic
1122717430 14:103703899-103703921 GAATGTAAAATGGTGCAGCTCGG + Intronic
1125039703 15:35170979-35171001 TAAAACACAATGGTGGAGCTTGG + Intergenic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1129206245 15:74038624-74038646 GAATTTGCAGTGGTGGTGCTGGG - Intronic
1130559219 15:84945424-84945446 GAATTCACACTGGGGGAGTTAGG - Exonic
1135056382 16:19235239-19235261 TAATATCCACTTGTGTAGCTTGG - Intronic
1139931467 16:70530292-70530314 GAATAGACAATAGTGGAGCTGGG - Intronic
1141821020 16:86445827-86445849 GAATAAACTCTGGAGGTGCTGGG - Intergenic
1143835253 17:9686845-9686867 GAGGATAGACTGCTGGAGCTGGG - Exonic
1144526127 17:15991748-15991770 GAAAAAACACTGGTAGAGCTTGG + Intronic
1146130057 17:30265201-30265223 GAATAATCACTGGTGGATTTTGG - Intronic
1149159384 17:53672506-53672528 TAATATACCATGGTGAAGCTGGG - Intergenic
1151581248 17:74980302-74980324 GAAGTAACAATGGTGGAGCTGGG - Intergenic
1152404297 17:80087698-80087720 GAATAAAAACCGGTGCAGCTCGG + Exonic
1154228125 18:12527153-12527175 GAAGAAACAGTGGAGGAGCTTGG - Intronic
1160051238 18:75435713-75435735 AAATATAAACTGGTGAATCTGGG + Intergenic
1161699818 19:5788411-5788433 AAATACACACAAGTGGAGCTTGG + Intronic
1162547614 19:11339878-11339900 GACTAGAAAGTGGTGGAGCTGGG - Intronic
1165432064 19:35778516-35778538 AAATATGCACCGGTGGAGGTGGG - Exonic
1166522426 19:43489709-43489731 GAAAAAACACTGGTGGGGCCAGG + Intronic
929250754 2:39752329-39752351 GAAAAAACGATGGTGGAGCTAGG + Intronic
929586920 2:43122080-43122102 GAGTAGACACTGGGGGATCTGGG - Intergenic
932144072 2:69303927-69303949 GAATCTGAACTGGTGTAGCTGGG + Intergenic
932168719 2:69533701-69533723 GAGGATATACTGGTGTAGCTGGG + Intronic
944153970 2:196592529-196592551 GAACATCCTCTGCTGGAGCTTGG - Exonic
944862079 2:203824695-203824717 GGATATACAGACGTGGAGCTAGG + Intergenic
946172173 2:217902088-217902110 GATTAGACAGGGGTGGAGCTGGG + Intronic
946424108 2:219583371-219583393 GAATGTACCCTGGTGAAGATTGG - Intergenic
1172564778 20:35920709-35920731 GCATGTCCACTGGTGGTGCTGGG - Intronic
1173728798 20:45314468-45314490 GAATGCACACTTGTGCAGCTGGG - Exonic
1177150159 21:17447111-17447133 TAATACAAACTGCTGGAGCTGGG - Intronic
1177821225 21:26032966-26032988 GAATGTTCATTGGTGGAGTTTGG + Intronic
1179553663 21:42159340-42159362 GAATATTCACTTAAGGAGCTGGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
953877401 3:46674141-46674163 GAATATCCACTGCTGAGGCTGGG - Intronic
959418386 3:106104396-106104418 GATTTTCCCCTGGTGGAGCTGGG - Intergenic
963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG + Intergenic
964902076 3:161671466-161671488 TAATATAGTCTGGTGGAGGTTGG + Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
976869521 4:89774190-89774212 GAATACCCAGAGGTGGAGCTGGG - Intronic
978002862 4:103578309-103578331 TAATATACAGTGGTGGAGAAAGG - Intergenic
978106767 4:104912024-104912046 GTATATACAGTGGTGGAGCAGGG + Intergenic
987716166 5:21574484-21574506 GTATATATCCTGGTAGAGCTAGG + Intergenic
990489636 5:56291754-56291776 GAATGTTCACTGTTGAAGCTGGG - Intergenic
992090239 5:73310608-73310630 GAATATAGAGGTGTGGAGCTTGG - Intergenic
999892190 5:155990836-155990858 GAAGGTAAATTGGTGGAGCTGGG + Intronic
1001021683 5:168188375-168188397 GAATACACAGTGGAGAAGCTTGG - Intronic
1004706818 6:18132160-18132182 GAACATAAAATGGTGGACCTAGG + Exonic
1005435157 6:25801954-25801976 GAACATCCACAGGTAGAGCTTGG + Intronic
1007507683 6:42348923-42348945 GACTTTGCAGTGGTGGAGCTGGG - Intronic
1010813659 6:80329450-80329472 GAATATATACAGGGGTAGCTAGG - Intronic
1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG + Intergenic
1012612731 6:101235728-101235750 GGATATACAGGAGTGGAGCTTGG + Intergenic
1015364504 6:132383002-132383024 GAATAGACCTTGGTTGAGCTTGG + Intronic
1021590206 7:22253009-22253031 GAACATGCACTGGTGGAGACAGG + Intronic
1021998643 7:26203128-26203150 TAATTTACACTGGGAGAGCTGGG - Intronic
1023925832 7:44669024-44669046 GAAAATACACTGAAGGAACTGGG - Intronic
1024672935 7:51613003-51613025 GACTACACAGTGGTGGAGCCTGG - Intergenic
1030007716 7:105135013-105135035 GAATATACACTGATTCACCTGGG + Intronic
1030253730 7:107482434-107482456 GAATATATATTGGTTGGGCTTGG - Intronic
1032243062 7:130180861-130180883 GAATGTAAAATGGTGCAGCTAGG + Intronic
1033708050 7:143907395-143907417 GAGAAGACACTGGTGGAGGTAGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1039115739 8:34089520-34089542 GAACTTACCCTGGTGGAGATTGG + Intergenic
1043357984 8:79436215-79436237 GAACATACAGTGGAGGATCTAGG - Intergenic
1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG + Intronic
1045397486 8:101775460-101775482 GAATCTACAGAGGTGGGGCTTGG - Intronic
1045793360 8:106012803-106012825 GAAGATCCACTGGTGAAGTTGGG - Intergenic
1047513218 8:125531234-125531256 GAAGATGCTCTGGTGGAGATGGG + Intergenic
1047962183 8:130018474-130018496 GATTAGACAGCGGTGGAGCTGGG + Intergenic
1049562685 8:143319671-143319693 GCATCTATGCTGGTGGAGCTAGG + Intronic
1052515670 9:29476370-29476392 AAATAGTCAGTGGTGGAGCTAGG + Intergenic
1058271132 9:102973012-102973034 GAATAAACACTGGTTAAGATGGG - Intergenic
1058622545 9:106898648-106898670 GAATACAAATTGGTGGTGCTGGG + Intronic
1060503688 9:124181929-124181951 GAATCTACAGTGGTTGAGCTGGG - Intergenic
1060998296 9:127887288-127887310 AAATAAACTCTGGCGGAGCTTGG + Intronic
1186548213 X:10473797-10473819 GAATATTCACTGGTAGAACCTGG - Intronic
1187312419 X:18158061-18158083 TAATACCCACTGCTGGAGCTGGG + Intergenic
1189101003 X:38189672-38189694 AAAGATAAACTGGGGGAGCTAGG - Intronic
1189116935 X:38352475-38352497 AAATACACAGCGGTGGAGCTTGG + Intronic
1192473441 X:71419453-71419475 GAATTTACACTGGAGCTGCTAGG + Intronic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1198370410 X:135984123-135984145 GAATACACACAGGGGCAGCTTGG + Intergenic