ID: 1182638622

View in Genome Browser
Species Human (GRCh38)
Location 22:31749696-31749718
Sequence TCCTCTCCGAGGAGATAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638615_1182638622 27 Left 1182638615 22:31749646-31749668 CCAACGGATGAGCGCTAAGAAAG No data
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG No data
1182638619_1182638622 -4 Left 1182638619 22:31749677-31749699 CCTCCGATAAGGGGCGTCGTCCT No data
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG No data
1182638620_1182638622 -7 Left 1182638620 22:31749680-31749702 CCGATAAGGGGCGTCGTCCTCTC No data
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638622 Original CRISPR TCCTCTCCGAGGAGATAAGT TGG Intronic