ID: 1182638622

View in Genome Browser
Species Human (GRCh38)
Location 22:31749696-31749718
Sequence TCCTCTCCGAGGAGATAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638615_1182638622 27 Left 1182638615 22:31749646-31749668 CCAACGGATGAGCGCTAAGAAAG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1182638620_1182638622 -7 Left 1182638620 22:31749680-31749702 CCGATAAGGGGCGTCGTCCTCTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1182638619_1182638622 -4 Left 1182638619 22:31749677-31749699 CCTCCGATAAGGGGCGTCGTCCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638622 Original CRISPR TCCTCTCCGAGGAGATAAGT TGG Intronic
901541785 1:9922509-9922531 GCCTCTCCTAGGAGATAAAAAGG + Intronic
902844133 1:19096152-19096174 TCCTCACTAAGGAGATTAGTTGG + Intronic
905840224 1:41170282-41170304 TCCTCTCCATGGGGAGAAGTTGG + Intronic
911091826 1:94023173-94023195 TCTTCTTGGAGGACATAAGTGGG - Intronic
911725608 1:101238338-101238360 TCTTTTCCGAGGAGAGACGTGGG + Intronic
916119166 1:161512497-161512519 TCCTCACTGAGGAAATGAGTGGG + Intronic
916128925 1:161594156-161594178 TCCTCACTGAGGAAATGAGTGGG + Intronic
916138837 1:161675987-161676009 TCCTCACTGAGGAAATGAGTGGG + Intronic
922436721 1:225614624-225614646 TCCCCTCCCAGGAGATAGGTTGG + Intronic
1063025663 10:2176702-2176724 GCCTTTCTGATGAGATAAGTTGG + Intergenic
1073443904 10:103569728-103569750 TCCTCACCAAGGAGACAAGACGG - Intronic
1076607141 10:131696439-131696461 ACCTTTCGGAGGCGATAAGTGGG + Intergenic
1076792951 10:132786336-132786358 TCGTCCCCGGGGAGATAAATCGG - Intergenic
1081648809 11:44809297-44809319 ACCTCTCGGTGGAGATAAATGGG - Intronic
1083944587 11:65916963-65916985 CCCTCTGCCAGGGGATAAGTAGG + Exonic
1084084097 11:66846871-66846893 TCCCCTCAGAGGAGATACGTCGG - Intergenic
1086220589 11:84438082-84438104 TCCTCTTGGAGGATATGAGTGGG - Intronic
1089659622 11:119977594-119977616 CCCACTCCCAGGAGATATGTTGG + Intergenic
1096914810 12:55020014-55020036 TCCTCTCCGGGGAGCTAACCAGG + Exonic
1101708579 12:107243611-107243633 TCCTTTCCAAGGAGCTGAGTTGG + Intergenic
1102193655 12:111008527-111008549 TCCTCTCAGAGGGGCAAAGTTGG - Intergenic
1103144363 12:118581722-118581744 TCCTCTGCTAGGAGATGAGTTGG + Intergenic
1113498373 13:110752158-110752180 TCCTCTCTGAGTATAGAAGTGGG - Intergenic
1122057984 14:99118037-99118059 TCCCCTCCGAGGCCACAAGTGGG + Intergenic
1124949596 15:34304928-34304950 TTTTCTCAGAGGAGTTAAGTGGG + Intronic
1133186841 16:4106084-4106106 TCCTTTCTGCGGAGTTAAGTGGG - Intronic
1135302401 16:21342063-21342085 TCTTCTCTGAGGGGATAATTTGG + Intergenic
1142417361 16:89949740-89949762 TCCTCCCCGATGAGAGCAGTGGG + Intronic
1143022626 17:3924713-3924735 TCCTTTCCCGGGAGACAAGTCGG - Intronic
1144733390 17:17541427-17541449 TTCTCTCCTGGGAGCTAAGTGGG - Intronic
1147164231 17:38585007-38585029 CCCTCTCTGTGGAGATAAGGAGG + Intronic
1152927224 17:83092782-83092804 GCCGCACTGAGGAGATAAGTGGG + Intronic
1167657868 19:50778067-50778089 CCTTCTCAGAGGAGAAAAGTGGG + Intergenic
1168717928 19:58539920-58539942 TCCTGTCTGAGGAGGAAAGTAGG - Intergenic
1168718066 19:58540498-58540520 TCCTGTCTGAGGAGGGAAGTAGG - Intergenic
1168718127 19:58540732-58540754 TCCTGTCTGAGGAGGAAAGTAGG - Intergenic
1168718418 19:58541931-58541953 TCCTGTCTGAGGAGGAAAGTAGG - Intergenic
1168718560 19:58542514-58542536 TCCTGTCTGAGGAGGAAAGTAGG - Intergenic
929359161 2:41063340-41063362 TCCCCTTTGAGGAGATAAGAGGG + Intergenic
929920633 2:46168910-46168932 TCCTCTCCGCAGAGATAGGCAGG - Intronic
932594953 2:73088010-73088032 TCCTCCCCAAGGAGCAAAGTTGG + Intronic
940192935 2:151061706-151061728 TCCTCACAGAGGTGATGAGTTGG - Intergenic
944566691 2:200998740-200998762 TCCTACCCGAGGATTTAAGTGGG - Intronic
946543069 2:220707034-220707056 TGCTCTCCAAGGAAAAAAGTAGG + Intergenic
1172495555 20:35380995-35381017 ACCTGTTCTAGGAGATAAGTGGG + Intronic
1174738392 20:52987113-52987135 TCCTCTCCCAGGATATCAGCGGG + Intronic
1176309273 21:5141215-5141237 TCCTCTCCCAGGAGACAGGAGGG + Intronic
1179175989 21:39008699-39008721 TCCTCTCTGAGGTGACAAGGTGG - Intergenic
1179847789 21:44120818-44120840 TCCTCTCCCAGGAGACAGGAGGG - Intronic
1180608655 22:17081315-17081337 TACCCTCCGGGGAGCTAAGTTGG + Intergenic
1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG + Intronic
951180322 3:19652171-19652193 TTCTCTCCACAGAGATAAGTTGG - Intergenic
952465175 3:33576721-33576743 TCCTCTCCTTCAAGATAAGTGGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953480071 3:43243722-43243744 TCTTCTGTGAGGAGGTAAGTGGG - Intergenic
953668160 3:44940793-44940815 TCCTCTCCAAGGAGGTATGAGGG + Intronic
955635907 3:61029356-61029378 TCCTCCCCGAGGGAATAACTAGG + Intronic
957369215 3:79269947-79269969 TCCTCTTTGAGGAAATAATTTGG - Intronic
961143478 3:124574991-124575013 TCCTCACCGAGGATCTATGTGGG + Intronic
961989769 3:131176028-131176050 TCCTTTCCAAGGAGGAAAGTTGG + Intronic
964669350 3:159208440-159208462 TCATCTCAGAGGAGAACAGTAGG - Intronic
970887385 4:21002082-21002104 TCTTCTTAGAGGAGATAAATAGG + Intronic
974049978 4:56931300-56931322 TCCTCTCCGAAAAGATAAAAAGG + Exonic
978752709 4:112270495-112270517 TCCTCTCTGAGGAGATAGCTTGG + Intergenic
985109898 4:186538178-186538200 TCCTCACCGAGGTGATAGCTGGG - Intronic
987507549 5:18793123-18793145 TCCTCTCACAGGAGAAAAGGGGG + Intergenic
990377100 5:55181788-55181810 TCCTCTATTAGCAGATAAGTGGG - Intergenic
995800633 5:115989975-115989997 TCCTCTCTGAGGAGGTGAGTTGG + Intronic
1006365587 6:33613305-33613327 TCCTCTCAGAGGAGAGGAGGAGG + Intergenic
1013176954 6:107686073-107686095 TCCTCTGCCAGAAGGTAAGTAGG + Intergenic
1014605088 6:123463486-123463508 GCCTCTGCTAGGAGATAACTTGG + Intronic
1018921570 6:168179437-168179459 TCCTCCCAGAGGAGAGAAGCTGG - Intergenic
1018984112 6:168622880-168622902 TCCTCTCCTTGGAGAAATGTGGG - Intronic
1024109399 7:46130054-46130076 TCCTGTAGTAGGAGATAAGTGGG + Intergenic
1029100499 7:98125962-98125984 TCCTCTCTGAAGAGAGAACTTGG + Intronic
1029422465 7:100478431-100478453 TCCTCTCCGGGGAGCAGAGTGGG + Intronic
1033110851 7:138574285-138574307 TTCTCTCAGAGGAAATGAGTAGG - Intronic
1034032226 7:147780723-147780745 TCCTCTCCTAGCAAATAAATAGG + Intronic
1038351475 8:26779915-26779937 TCCTTTCCAAGGAGATAGGATGG + Intronic
1043242674 8:77955780-77955802 TCCTCTCCCAGGAACTCAGTGGG - Intergenic
1053368046 9:37537666-37537688 TCCTCTGTGGGGAGAAAAGTGGG + Exonic
1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG + Intronic
1060961999 9:127687605-127687627 TCCTCTCCTAAAAGATATGTTGG - Intronic
1062272753 9:135717369-135717391 TCCTCTCAGAGGTGAGAAGTGGG - Intronic
1195560113 X:106273575-106273597 TTCTCTGCGAGGAGAAAAGCAGG - Intergenic
1195561849 X:106292764-106292786 TTCTCTGCGAGGAGAAAAGCAGG + Intergenic
1199618678 X:149679887-149679909 TCCTCTCCTAGGAAATACCTTGG - Intergenic
1199623964 X:149723362-149723384 TCCTCTCCTAGGAAATACCTTGG + Intergenic
1201520928 Y:14872801-14872823 TCCTCTCCTTGGAGATATTTTGG - Intergenic