ID: 1182638825

View in Genome Browser
Species Human (GRCh38)
Location 22:31750690-31750712
Sequence TTTGTGCCGGACACTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638825_1182638829 8 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638829 22:31750721-31750743 CTCAATGGACATTTGAAGGAAGG No data
1182638825_1182638827 -7 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638827 22:31750706-31750728 GCACAAAACTAGACGCTCAATGG No data
1182638825_1182638828 4 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638828 22:31750717-31750739 GACGCTCAATGGACATTTGAAGG No data
1182638825_1182638830 28 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638830 22:31750741-31750763 AGGAAGAAATGTTTATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638825 Original CRISPR TTTGTGCCGGACACTGCTCT TGG (reversed) Intergenic
No off target data available for this crispr