ID: 1182638826

View in Genome Browser
Species Human (GRCh38)
Location 22:31750703-31750725
Sequence TTGAGCGTCTAGTTTTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638826_1182638829 -5 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638829 22:31750721-31750743 CTCAATGGACATTTGAAGGAAGG No data
1182638826_1182638831 26 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638831 22:31750752-31750774 TTTATCCAGTGGAAGAATTGAGG No data
1182638826_1182638830 15 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638830 22:31750741-31750763 AGGAAGAAATGTTTATCCAGTGG No data
1182638826_1182638828 -9 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638828 22:31750717-31750739 GACGCTCAATGGACATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638826 Original CRISPR TTGAGCGTCTAGTTTTGTGC CGG (reversed) Intergenic
No off target data available for this crispr