ID: 1182638827

View in Genome Browser
Species Human (GRCh38)
Location 22:31750706-31750728
Sequence GCACAAAACTAGACGCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638823_1182638827 28 Left 1182638823 22:31750655-31750677 CCTTGTCTGTTTTGTTCATCACT No data
Right 1182638827 22:31750706-31750728 GCACAAAACTAGACGCTCAATGG No data
1182638825_1182638827 -7 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638827 22:31750706-31750728 GCACAAAACTAGACGCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638827 Original CRISPR GCACAAAACTAGACGCTCAA TGG Intergenic
No off target data available for this crispr