ID: 1182638829

View in Genome Browser
Species Human (GRCh38)
Location 22:31750721-31750743
Sequence CTCAATGGACATTTGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638825_1182638829 8 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638829 22:31750721-31750743 CTCAATGGACATTTGAAGGAAGG No data
1182638826_1182638829 -5 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638829 22:31750721-31750743 CTCAATGGACATTTGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638829 Original CRISPR CTCAATGGACATTTGAAGGA AGG Intergenic
No off target data available for this crispr