ID: 1182638830

View in Genome Browser
Species Human (GRCh38)
Location 22:31750741-31750763
Sequence AGGAAGAAATGTTTATCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182638826_1182638830 15 Left 1182638826 22:31750703-31750725 CCGGCACAAAACTAGACGCTCAA No data
Right 1182638830 22:31750741-31750763 AGGAAGAAATGTTTATCCAGTGG No data
1182638825_1182638830 28 Left 1182638825 22:31750690-31750712 CCAAGAGCAGTGTCCGGCACAAA No data
Right 1182638830 22:31750741-31750763 AGGAAGAAATGTTTATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182638830 Original CRISPR AGGAAGAAATGTTTATCCAG TGG Intergenic
No off target data available for this crispr