ID: 1182639315

View in Genome Browser
Species Human (GRCh38)
Location 22:31753947-31753969
Sequence AAGGAGGCGGGGCCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 663}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182639301_1182639315 11 Left 1182639301 22:31753913-31753935 CCCGGCGAGAGCGGCGCGGGGGC No data
Right 1182639315 22:31753947-31753969 AAGGAGGCGGGGCCCCGGGGCGG 0: 1
1: 0
2: 4
3: 73
4: 663
1182639302_1182639315 10 Left 1182639302 22:31753914-31753936 CCGGCGAGAGCGGCGCGGGGGCG No data
Right 1182639315 22:31753947-31753969 AAGGAGGCGGGGCCCCGGGGCGG 0: 1
1: 0
2: 4
3: 73
4: 663
1182639295_1182639315 28 Left 1182639295 22:31753896-31753918 CCGAGACGAGACGGAGGCCCGGC No data
Right 1182639315 22:31753947-31753969 AAGGAGGCGGGGCCCCGGGGCGG 0: 1
1: 0
2: 4
3: 73
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182639315 Original CRISPR AAGGAGGCGGGGCCCCGGGG CGG Intronic