ID: 1182647143

View in Genome Browser
Species Human (GRCh38)
Location 22:31819346-31819368
Sequence TGGGATGGCCAAAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182647143_1182647153 13 Left 1182647143 22:31819346-31819368 CCATGCCCACTTTGGCCATCCCA 0: 1
1: 0
2: 2
3: 24
4: 289
Right 1182647153 22:31819382-31819404 AGATCCTTGAAGATGCACTTGGG 0: 1
1: 0
2: 0
3: 23
4: 137
1182647143_1182647152 12 Left 1182647143 22:31819346-31819368 CCATGCCCACTTTGGCCATCCCA 0: 1
1: 0
2: 2
3: 24
4: 289
Right 1182647152 22:31819381-31819403 AAGATCCTTGAAGATGCACTTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1182647143_1182647155 19 Left 1182647143 22:31819346-31819368 CCATGCCCACTTTGGCCATCCCA 0: 1
1: 0
2: 2
3: 24
4: 289
Right 1182647155 22:31819388-31819410 TTGAAGATGCACTTGGGAATAGG 0: 1
1: 0
2: 2
3: 8
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182647143 Original CRISPR TGGGATGGCCAAAGTGGGCA TGG (reversed) Intronic
900187470 1:1339111-1339133 TGGGCTGCACAAGGTGGGCACGG + Intronic
900781633 1:4622473-4622495 AGTGTTGGCCACAGTGGGCAGGG + Intergenic
902303962 1:15523221-15523243 GGGGCTGGCCAAAGAGGGCAGGG + Intronic
903017156 1:20368576-20368598 TAGGATGGCCAAAGGGAGAATGG - Intergenic
903232651 1:21931372-21931394 TGGCAGGGCCAAAGAGGCCAAGG + Intronic
906623096 1:47300867-47300889 TAGGAAGGACACAGTGGGCATGG - Intronic
907236530 1:53054183-53054205 AGAGATGGCCAAAATGGGAATGG + Intergenic
907568693 1:55462114-55462136 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
909126944 1:71684637-71684659 TGGAATGGCCACACAGGGCAGGG - Intronic
913117631 1:115711483-115711505 TGGGTTGGGCAAAGTGTGTAGGG + Intronic
914929781 1:151920837-151920859 TGGCATGCCCAGAGAGGGCATGG - Intergenic
915279710 1:154814076-154814098 AGGGAGGGCCATGGTGGGCATGG + Intronic
915543406 1:156582643-156582665 TGGGAAGGCAGCAGTGGGCAGGG + Intronic
915974660 1:160377262-160377284 TGGGATGTCCAAAGAGGGGCAGG - Intergenic
917895260 1:179481124-179481146 TGGGGTGGGGAAAGTGGGGAGGG - Intronic
920055608 1:203188834-203188856 TGGGCTGGCCAAGGTGAGGAAGG - Intergenic
924791016 1:247248172-247248194 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
1063340448 10:5258136-5258158 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
1063937739 10:11096606-11096628 TTGTATGGCCAGACTGGGCATGG + Intronic
1064621599 10:17222961-17222983 AGGGATTCCCAAAGTGGGAAGGG - Intergenic
1065706672 10:28477105-28477127 TGGCATCTCCAAAATGGGCAAGG + Intergenic
1068117747 10:52752618-52752640 GGGGATGGGCATAGTGGGCCAGG + Intergenic
1068303294 10:55174504-55174526 TGAGATGGCCAAAGTGTCCAAGG + Intronic
1068576774 10:58693002-58693024 TGGGGTGGGCAGAGTGGGGAGGG - Intronic
1068688357 10:59891818-59891840 TGGGATGGTAAGAGAGGGCAAGG - Intronic
1069589834 10:69634864-69634886 CAGGATGGCGGAAGTGGGCAGGG + Intergenic
1069806975 10:71132261-71132283 TGGGACTCCCAAAGCGGGCAAGG - Intergenic
1070163527 10:73880876-73880898 TGGTGTGGCCAGAGTGGGCCAGG + Intergenic
1071219050 10:83442037-83442059 TGGGGTGGCAGGAGTGGGCAGGG + Intergenic
1071569055 10:86686499-86686521 TGGGAAAGCCAAGATGGGCAAGG + Intronic
1072092209 10:92139548-92139570 TGGGTGGGTAAAAGTGGGCATGG + Intronic
1073606052 10:104896582-104896604 AGGGATGGGGCAAGTGGGCAGGG + Intronic
1075734992 10:124659054-124659076 TGGGATGGCGATGGTGGGGATGG + Intronic
1076909504 10:133379905-133379927 TGGGAAGGCCAGCGTGGGCGTGG + Intronic
1077520358 11:3029706-3029728 TGGGAGGGCCGAGGTGGGCCTGG + Intronic
1080072647 11:28108339-28108361 GGCGGTGGCCAAAGTGGGCGGGG + Exonic
1081316105 11:41632335-41632357 TTGGGAGGCCAAAGCGGGCAAGG + Intergenic
1081515232 11:43822473-43822495 TGGGGTGGGGAAAGTGGGGAGGG - Intronic
1081742062 11:45447873-45447895 TGAGATGGCCACAGTGGCCTGGG + Intergenic
1081765652 11:45608311-45608333 TGGTCTGGCCATAGTGGGGAGGG - Intergenic
1081808342 11:45901890-45901912 AGGGATGGCCTGAGGGGGCAGGG + Intronic
1083699687 11:64467736-64467758 TGGTATGGCCAGAGAGGGCATGG + Intergenic
1083741073 11:64712131-64712153 TGGAAAGGCCAGTGTGGGCAGGG - Intronic
1084308009 11:68299171-68299193 GTGGATGGGCACAGTGGGCAGGG + Intergenic
1084918155 11:72446900-72446922 TGGGTTGGGCAAAGTGGGGCTGG + Intergenic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085291323 11:75401983-75402005 TGGCATGGCCAAAGGAGCCAGGG + Intronic
1087036266 11:93758941-93758963 TGGGATGATCACAGTGGGCCTGG - Intronic
1088916588 11:114232472-114232494 TGGGATGGAGCAAGTAGGCAGGG - Intronic
1089668152 11:120033269-120033291 TTGGATGGACAAAGTAGACAGGG - Intergenic
1091825430 12:3508994-3509016 AGGGACGGCCACAGTGGGCCTGG - Intronic
1092109486 12:5948827-5948849 TGAGATGGCAACGGTGGGCAGGG - Intergenic
1092613129 12:10192377-10192399 TGGGATGGACACAGGGGACAGGG - Intergenic
1092967319 12:13657059-13657081 TGGGATTGCCAGAGTAGGGAAGG + Intronic
1094722972 12:33084073-33084095 TGGGAGGGACAAAGTGGGACGGG - Intergenic
1094822909 12:34240833-34240855 TGGGAGGGCCAAAGTCTGGAGGG + Intergenic
1094856206 12:34403969-34403991 TGGGCTGGCCCCAGTGGGCCTGG - Intergenic
1095171949 12:39046605-39046627 TTGGAAGGCCAAGGTGGGCAGGG + Intergenic
1095628996 12:44352436-44352458 TGGGGTGGGGAAAGTGGGGAGGG - Intronic
1096868797 12:54580450-54580472 TGGGATGGCCAGAAGGGGAAGGG - Intronic
1099012602 12:77309701-77309723 TTGGGAGGCCAAAGTGGGGATGG - Intergenic
1099016980 12:77355103-77355125 GGGGATGGCAAAATTGGGGATGG + Intergenic
1099103433 12:78471639-78471661 TGGCATGCCCAGAGAGGGCATGG + Intergenic
1099365298 12:81759594-81759616 AGGGATGGGCAAAGTGGGAAGGG + Intergenic
1099630478 12:85136381-85136403 TGGCATGGGGAAAGTGGGTAGGG + Intronic
1100186300 12:92144598-92144620 GGGGATGGAAAAAGCGGGCAGGG + Intronic
1101114807 12:101521705-101521727 TGGGTTTTCCAAAGTGGGCAAGG - Intergenic
1103293413 12:119866053-119866075 TGGAATGCCCAAAGGGGTCAGGG - Intronic
1103820862 12:123697733-123697755 TTGGGAGGCCAAGGTGGGCAAGG - Intronic
1104370475 12:128219769-128219791 TGGGCTTTCCACAGTGGGCAGGG + Intergenic
1105893878 13:24701870-24701892 TCGGTTGGCCAAAGTGGGGATGG - Intronic
1106077791 13:26475888-26475910 TGGGATGGGGCAAGGGGGCAAGG + Intergenic
1106790984 13:33154587-33154609 AGTGATGGCCAAAGTGGCCCGGG + Intronic
1107434806 13:40372911-40372933 TGGGAGGGGGAGAGTGGGCAGGG - Intergenic
1107618710 13:42201279-42201301 GGGTGTGGCCAAACTGGGCACGG - Intronic
1107840482 13:44451947-44451969 TGGGAGCGCAAAAGTGGGAAAGG - Intronic
1107885442 13:44871176-44871198 GGAGATGGCAAAAGTGGACAGGG - Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109332016 13:60942007-60942029 TGGCATGCCCAGAGAGGGCATGG - Intergenic
1113594338 13:111520732-111520754 GGGGAAGGCCAAGCTGGGCAGGG - Intergenic
1116170696 14:41398248-41398270 TTGGATGGCCAAAGATGGAATGG + Intergenic
1119553077 14:75530753-75530775 TTGGGAGGCCAAGGTGGGCAGGG - Intronic
1120289873 14:82554173-82554195 TGGGATGACTACAATGGGCATGG - Intergenic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1121418249 14:93794094-93794116 TAGGATGGCCAAAGAGGGGCTGG - Intergenic
1121675440 14:95748696-95748718 TGGGATGACGAAAGTAGGGACGG + Intergenic
1122005771 14:98702446-98702468 AGGCATGGTCAAAGTGGGGAAGG - Intergenic
1122257424 14:100489049-100489071 TGGGATCGACATAGAGGGCATGG + Intronic
1122428514 14:101625415-101625437 TGGGAAGCAGAAAGTGGGCAGGG - Intergenic
1122556701 14:102584404-102584426 ACGGATGGCCCTAGTGGGCAGGG - Intergenic
1125533628 15:40429713-40429735 TGGGAGGGCAGGAGTGGGCAGGG + Intronic
1125617163 15:41025069-41025091 TGGGAGGGGCCAAGTGGGAAAGG + Intronic
1126132016 15:45350962-45350984 GGGTGTGGCCAAAGTGGCCAAGG + Intergenic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1129314701 15:74734453-74734475 TGGGATGGCCAAGGAAGGTAAGG - Intergenic
1129727648 15:77909680-77909702 TGGGAGGGCCAGGGTGGGGAGGG - Intergenic
1130232885 15:82109930-82109952 TGGGATGGGGCAAGTCGGCAAGG + Intergenic
1130416418 15:83698586-83698608 TGGGGTGACCAAAGGGGTCAGGG - Intronic
1131353919 15:91726617-91726639 TGGGAAGGCCATATTGGGGAAGG - Intergenic
1132129717 15:99264670-99264692 TGGGATGGGCATAGTGGGAGGGG + Intronic
1133244481 16:4438770-4438792 TAGGATGGCCAAAGTCGGGCAGG - Intronic
1133770266 16:8863647-8863669 TGGGGTGGCCAGAGTAGGCCTGG + Intronic
1133781442 16:8942113-8942135 TGGGAAGGGGAAGGTGGGCAGGG + Intronic
1134030768 16:10990594-10990616 TGGAGTGGGCACAGTGGGCAGGG + Intronic
1134814561 16:17195136-17195158 GTGGTTGGCAAAAGTGGGCAGGG + Intronic
1139605634 16:68016197-68016219 TGGGATGGACAAAGGGATCATGG + Intronic
1140040465 16:71404103-71404125 AGAGATGGCCCAAGAGGGCAGGG + Intergenic
1140642457 16:76992257-76992279 TGTGCTGGACAAAGTGGGAATGG - Intergenic
1140848192 16:78909651-78909673 TGGGATGGACACAGAGGTCAGGG - Intronic
1140951334 16:79820736-79820758 TGGGATGGCCAAACTCAGGAAGG + Intergenic
1141132974 16:81447510-81447532 TGGGCTGGCCAAGGTGAGCGAGG - Intronic
1143103833 17:4518770-4518792 TGGGCTGGCCAAAGACGGGAGGG - Intronic
1143580955 17:7825627-7825649 GGGGAGGGCCAAAGAGGGGAGGG + Intronic
1143762794 17:9117029-9117051 TGGGATGGCCCCACTGGGCGGGG + Intronic
1143874597 17:9982069-9982091 TGGGATGGTGGAAGGGGGCAGGG - Intronic
1144414097 17:15029875-15029897 TGGCTTGGCCACTGTGGGCAGGG - Intergenic
1146929648 17:36768287-36768309 GGGGATGACCAAAATGGCCATGG - Intergenic
1147475786 17:40710324-40710346 TGGTATGTCCAGAGAGGGCATGG + Intergenic
1147892614 17:43727927-43727949 TTGGGAGGCCAAAGTGGGGATGG + Intergenic
1147952322 17:44114120-44114142 TGGAATGGCCAGAGAAGGCAGGG - Intronic
1148104762 17:45113287-45113309 GGGGATGGCCAAGGTGGGCGTGG - Intronic
1148872864 17:50668829-50668851 TGAGAGGACCAAGGTGGGCAGGG - Intronic
1150178610 17:63090353-63090375 TGGGGTGGGGAAAGTGGGGAGGG - Intronic
1150623522 17:66825742-66825764 TGGGGTGGCGGAAGTGGGGAGGG - Intergenic
1151482505 17:74378744-74378766 GGGGAGGACCAAAGTGAGCATGG - Intergenic
1152137692 17:78514647-78514669 TGGTAAAGCCAATGTGGGCAGGG - Intronic
1152600302 17:81258938-81258960 CCGGATGGCGAAGGTGGGCAGGG - Intronic
1153248421 18:3096108-3096130 TTGAATGTCCACAGTGGGCACGG + Intronic
1154375244 18:13803579-13803601 TGTGATGGAGAAAGTGGGCAGGG - Intergenic
1155037399 18:22036454-22036476 TAGGATGGACAAAGTGAGAATGG - Intergenic
1155860950 18:30898718-30898740 TGGGATGGGCAGAGAGGGGAGGG + Intergenic
1157226877 18:45874220-45874242 TGGAATGTCCAGAGTGGGGAAGG + Intronic
1158030261 18:52954985-52955007 TGGGATGGTCATAGTGAGGAAGG - Intronic
1158607345 18:58907428-58907450 TTGGGAGGCCAAGGTGGGCAGGG - Intronic
1160348200 18:78152017-78152039 TGGCAAGACCCAAGTGGGCAGGG - Intergenic
1160571133 18:79818348-79818370 CGGGCTGGCCAAGGTGGGCATGG - Intergenic
1161285803 19:3467699-3467721 TGGGGAGGCCAGAGTGGGTAGGG - Intronic
1161651063 19:5485336-5485358 TGGGATGGCCTCAGTGGGTCAGG - Intergenic
1162376564 19:10308729-10308751 TGGGAGGCCCACAGTGGGCGAGG - Exonic
1162712839 19:12608946-12608968 TGGGATGGCCAATGAAGGTAAGG + Intronic
1163200172 19:15761034-15761056 TGGAATTGACAAAGAGGGCAGGG + Intergenic
1163513934 19:17751697-17751719 TGGGCTGGCCAAAGCCTGCATGG + Intronic
1165726358 19:38115607-38115629 AGGGAAGGCCAGGGTGGGCATGG - Intronic
1165996449 19:39847151-39847173 TGGGTGGGGCAAAGTGAGCAAGG + Intergenic
1168646781 19:58064213-58064235 AGGGATGGCCAGTGTGGGAAAGG + Intronic
925618501 2:5767300-5767322 TGGGCTTGCCAAAGTGAGTAGGG + Intergenic
926188157 2:10707814-10707836 TTGGGAGGCCAAAGTGGGGAAGG - Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
927593164 2:24374182-24374204 TGGCATGTCCAGAGAGGGCATGG + Intergenic
927928271 2:27027635-27027657 TGGGATGGCCACAAAGAGCAAGG + Intergenic
928466749 2:31529369-31529391 TGGGAGGGACCAAGTGGCCAGGG + Exonic
929883786 2:45860715-45860737 AGCACTGGCCAAAGTGGGCAGGG - Intronic
930933754 2:56920682-56920704 TGGCATGCCCAGAGAGGGCATGG + Intergenic
931562404 2:63576488-63576510 TGGCATGCCCAAAGAGGACATGG - Intronic
931682730 2:64765798-64765820 GGGGATGGCAGAAGTGGGGATGG + Intergenic
931714903 2:65021230-65021252 TGGGAGGGTAAAAGTTGGCAAGG - Exonic
932220196 2:69993284-69993306 TGGGATGGCCTAAGTAGCCATGG - Intergenic
933453955 2:82497702-82497724 TGGGATGGACCATGTAGGCAAGG - Intergenic
935689362 2:105716413-105716435 TGGAGTGGACAAAGTAGGCATGG + Intergenic
936493157 2:112993185-112993207 TGGGCAGGCCATAGTGGCCATGG - Intergenic
938735651 2:134184309-134184331 TAGAGAGGCCAAAGTGGGCAGGG - Intronic
940462342 2:153981357-153981379 TGGGGTGGGCAGAGTGGGGAGGG - Intronic
941274105 2:163469219-163469241 TGGGGTGGGCAGAGTGGGGAGGG - Intergenic
942834587 2:180278104-180278126 TGGGATGGGGGAAGTGGGGAGGG + Intergenic
943648551 2:190432289-190432311 TGGGATGGGGAAAGGGGCCAAGG + Intronic
946179494 2:217941191-217941213 TGGGGAGGCCAAACTGGGCAGGG + Intronic
946568804 2:220998341-220998363 TTGAATGGCCACAGTGGGCCAGG + Intergenic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947008261 2:225537116-225537138 GGGGTTGGGGAAAGTGGGCATGG - Intronic
947395832 2:229686063-229686085 TGGGATGGACAAAGTGGGCTGGG + Intronic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
947915715 2:233830611-233830633 TGGGATGGCCCAGGTGGCCCAGG + Intronic
1168792182 20:585554-585576 TGTGATGACCAAAGTGGAGAGGG + Intergenic
1169610292 20:7372165-7372187 TGGAAAGGCCAAAGGTGGCAAGG - Intergenic
1172130269 20:32650584-32650606 AGGGATGCCCAGAATGGGCACGG - Intergenic
1172198553 20:33109033-33109055 TTGGATGGGCAGTGTGGGCAGGG + Intronic
1172744170 20:37193891-37193913 TGGGATGGCCTAGGGAGGCAGGG + Intronic
1173474580 20:43349974-43349996 TGTGATGGGCAAAGAGGCCAGGG + Intergenic
1173491246 20:43484205-43484227 CAGGATGGCTAAAGAGGGCAGGG + Intergenic
1173707584 20:45123986-45124008 AGGGATGGCTAAAGCTGGCAGGG - Intronic
1174615510 20:51832474-51832496 TGGGAGGGCCAAGGTGGGGCTGG + Intergenic
1175233801 20:57494299-57494321 TTGGAAGACCAAGGTGGGCAGGG - Intergenic
1178470192 21:32885701-32885723 TGGGATGGCAGGAGTGGGGAGGG - Intergenic
1179247057 21:39643088-39643110 TGGGATAGACACAGTGGGGAGGG + Intronic
1179516828 21:41914377-41914399 TGGGAAGGCCAAGGAGGGAAAGG - Intronic
1181000507 22:19985901-19985923 TGGGAGGGCCATAATGGGGATGG - Intronic
1181671682 22:24428202-24428224 TGGGATGGCCCAGGGGGGCCTGG - Intronic
1181871282 22:25901270-25901292 TGATATGGCAGAAGTGGGCATGG - Intronic
1182647143 22:31819346-31819368 TGGGATGGCCAAAGTGGGCATGG - Intronic
1184120461 22:42446403-42446425 GGGGATGGCCAAGGAGTGCAGGG + Intergenic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
949730500 3:7106854-7106876 TGGGCAGGCAAAACTGGGCAGGG - Intronic
950090459 3:10290966-10290988 CGGGGTGCCCCAAGTGGGCATGG + Exonic
950148126 3:10666268-10666290 AGAGATGACCAGAGTGGGCACGG + Intronic
950174762 3:10865317-10865339 CAGGATGGCCAAATTTGGCATGG - Intronic
953147300 3:40290657-40290679 TGGCTTGTCCACAGTGGGCATGG - Intergenic
953181276 3:40597365-40597387 TGGTTTGGCCAAAGTGGGAGTGG + Intergenic
953919647 3:46943134-46943156 GGTGATGGCCAAAGAGGGAAGGG + Intronic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
957974043 3:87420357-87420379 TGGAATGTTCACAGTGGGCAAGG + Intergenic
959442123 3:106390095-106390117 TGGAATGTCCAGAGTGGCCAGGG + Intergenic
959671517 3:108982843-108982865 GGTGATTGCCAAAGTGGGAATGG - Intronic
961365614 3:126397697-126397719 TGGCATGGGCAAGGTGGGCAGGG + Intronic
962168737 3:133078068-133078090 AGGGATGGCAAAATGGGGCAAGG + Intronic
962194840 3:133352730-133352752 TGGGATGCCCAGAAAGGGCATGG - Intronic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
966338418 3:178897831-178897853 TGACATGTCCAAAGTGGGAAAGG - Intergenic
967614553 3:191548684-191548706 TGAGAAGGCGAGAGTGGGCAAGG - Intergenic
968068161 3:195770451-195770473 TGGGTGGGCTGAAGTGGGCAGGG - Intronic
969181581 4:5446115-5446137 TGGGATGCCCTGAGGGGGCATGG - Intronic
969230416 4:5826625-5826647 AGGGATGGCCAAGGTTGGGAGGG + Intronic
969648039 4:8444944-8444966 TGGGGTTGCCACACTGGGCAGGG + Intronic
970364175 4:15341811-15341833 TGGGATGGCCAGCGTTTGCATGG + Intronic
971023630 4:22565871-22565893 TGGCATGCCCAGAGAGGGCATGG + Intergenic
971181362 4:24331161-24331183 TGTGCTGGGCAAAGTGGGGATGG - Intergenic
974149115 4:57982825-57982847 TGGGAGGGGAAAAGTGGGCAGGG + Intergenic
974785880 4:66619229-66619251 TCAGATGGCCAATTTGGGCAAGG + Intergenic
974894995 4:67927542-67927564 TGGGTTGGCCTTGGTGGGCATGG + Intronic
975045591 4:69799419-69799441 TGGGAAGACCTCAGTGGGCATGG + Intergenic
975176931 4:71299870-71299892 TGGGGTGACCAAAGTAGGGAAGG + Intronic
975331254 4:73116478-73116500 TGGGCTAGACAAAGTGGGAATGG - Intronic
976905726 4:90233473-90233495 TGGGGTGGGGAAAGTGGGGAGGG + Intronic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
981807055 4:148728775-148728797 TGGGAGGGCCATTGTGGGCCCGG + Intergenic
986165162 5:5266668-5266690 GGGGATGGCCCCAGTGGGAAGGG + Intronic
987395676 5:17420885-17420907 TGGGATGTCCTCAGTGTGCAGGG - Intergenic
987570989 5:19658793-19658815 TGGGGTGGGCGAAGTGGGGAGGG - Intronic
987688851 5:21241592-21241614 TTGGATAGGTAAAGTGGGCAAGG - Intergenic
988198788 5:28044504-28044526 TGGGATGGGGAGAGGGGGCAGGG + Intergenic
988348515 5:30070389-30070411 TGGGAGGGCCAAAGTGCTCCCGG - Intergenic
988696621 5:33627804-33627826 TGAGATGGCCAAAATGGCCTTGG + Intronic
989182711 5:38594542-38594564 TGGGGTGGACAGGGTGGGCAGGG + Intronic
989947352 5:50254607-50254629 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
991492578 5:67197252-67197274 GGGGATGGACAAGGTGGCCAAGG - Intergenic
992865016 5:80949528-80949550 TGTAATGGGGAAAGTGGGCAGGG - Intergenic
993568524 5:89506427-89506449 TGGGATGGCAGAAGTAGGCATGG - Intergenic
995012375 5:107271822-107271844 TGGGCTGGCCAAAGTTTGCATGG - Intergenic
995259621 5:110087085-110087107 TCAGACAGCCAAAGTGGGCAGGG + Intergenic
997869354 5:137493462-137493484 TGGGAAGGCCAACTGGGGCAAGG + Intronic
998699482 5:144681607-144681629 TGGGATTTGCAAAGTGGCCAGGG + Intergenic
999305639 5:150517870-150517892 TTGGGTGGCCAACGTGGGCAGGG + Intronic
999776437 5:154816077-154816099 TGGGAGGGCAAAGGTGGGGAAGG - Exonic
1000399334 5:160809267-160809289 TCTGCTGGCCAAAATGGGCATGG + Intronic
1002045060 5:176536982-176537004 TAGGACGGCCAAACTGGGCAGGG + Exonic
1002341061 5:178516793-178516815 TGGGGTGGACAAGGTGGGCACGG - Intronic
1002866569 6:1127218-1127240 CTGGATGGGCAAAGTGAGCAAGG - Intergenic
1006042797 6:31269847-31269869 TGGGATGGCCCATGTGTGGATGG + Intronic
1006092299 6:31635210-31635232 TGGGATGGCCGAATGGGGCCAGG - Exonic
1007231935 6:40354315-40354337 TGGGATTGCCCAAGAGGACAAGG - Intergenic
1007535879 6:42588289-42588311 TGGCATGCCCAGAGAGGGCATGG - Intronic
1007621824 6:43220191-43220213 TGGGATGGACAAGGAGGGAATGG - Intronic
1008046645 6:46858369-46858391 TGGGATGGCGAAAGCCAGCAGGG + Exonic
1009853213 6:69225274-69225296 TGAGATGGTCATGGTGGGCATGG - Intronic
1012489375 6:99763794-99763816 TGAGGTTGCCAAAGTAGGCAGGG + Intergenic
1017711314 6:157170677-157170699 GGGGGTGGCCACAGTGGGGAGGG + Intronic
1019464887 7:1182255-1182277 CGGGAGGGGCAAAGTGGGCAAGG + Intergenic
1019475917 7:1244166-1244188 TGGGATGGCAGCAGTGGGCCCGG - Intergenic
1019623690 7:2004600-2004622 TGGGCTGGCCACCGTGGTCACGG - Intronic
1019737682 7:2658744-2658766 TGGCTGGGCCAAGGTGGGCAGGG + Intronic
1021507744 7:21403995-21404017 TGTCATGCCCAAAGAGGGCATGG - Intergenic
1023095916 7:36659567-36659589 TGGGAAAGAAAAAGTGGGCAGGG + Intronic
1023899193 7:44461921-44461943 TGGGATGGACACAGTTGGGATGG + Intronic
1024510451 7:50199999-50200021 TGGAATGGCCCAAGTGGCCCAGG + Intergenic
1027498456 7:78917922-78917944 TGGCATGCCCTAAGAGGGCATGG - Intronic
1027803201 7:82781890-82781912 TGGCATGCCCAGGGTGGGCATGG + Intronic
1027861276 7:83585199-83585221 TGGGATGGTGAGAGTGGTCAGGG - Intronic
1030206413 7:106956623-106956645 TGTGATTGCAAAAGTGGGCAAGG - Intergenic
1031595118 7:123640745-123640767 GGGGAAGGCAAAAGGGGGCAGGG + Intergenic
1032825878 7:135567339-135567361 TGGGAAGGCCAAGGTGGGCAGGG + Intronic
1033303253 7:140205209-140205231 TGGGTTGCCCTAAGTTGGCAGGG + Intergenic
1033355173 7:140593623-140593645 TTGGATGGCAACACTGGGCAAGG - Intronic
1033598046 7:142870516-142870538 TGGGAAGGCCTAAGAGGGGAGGG - Exonic
1034472480 7:151262788-151262810 TGGGATGCCCAAGGCTGGCATGG + Intronic
1035453007 7:158991064-158991086 TAGAATGGCCAAAGTCGGCCAGG + Intergenic
1035936126 8:3841871-3841893 TGGGTTGGCCACACTGGCCACGG + Intronic
1036145074 8:6247521-6247543 AGGTAGGGCCAAAGTGGGTAAGG - Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1038987986 8:32834217-32834239 TGGAGAGTCCAAAGTGGGCAGGG + Intergenic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1040428303 8:47311860-47311882 TGGGATGGGGGAAGTGGGGAGGG - Intronic
1040617265 8:49049356-49049378 TGGGAGGGAAAAAGGGGGCAAGG - Intergenic
1042559985 8:70066195-70066217 TGGGATGCCCTCATTGGGCAAGG + Intronic
1044614973 8:94130662-94130684 TGGGATACCCACTGTGGGCATGG - Exonic
1045950954 8:107851034-107851056 TGGGATGGGAAAAGAGGGGAGGG + Intergenic
1047748979 8:127865954-127865976 AGGGATGGCTTAAGTAGGCAGGG + Intergenic
1049010725 8:139885461-139885483 TGGGATGGCAAAAGAGAACAGGG - Intronic
1049436605 8:142589038-142589060 GGTGATGACCACAGTGGGCAGGG + Intergenic
1050697698 9:8297627-8297649 TGAGATGGCTTAAGTGAGCAAGG - Intergenic
1052316640 9:27122544-27122566 TGAGATTGGCCAAGTGGGCAGGG + Intronic
1053130338 9:35610959-35610981 TGGGAAGGCCAGGCTGGGCACGG + Intronic
1053168027 9:35858384-35858406 TTGGAAGGCAAAAGTGGGCCAGG - Intergenic
1053901142 9:42796525-42796547 TGGGATGGCAAAAGCCAGCAGGG - Intergenic
1054260503 9:62861039-62861061 TGGGATGGCAAAAGCCAGCAGGG + Intergenic
1055058367 9:72044296-72044318 TGGGAAGTCCAAAGTCTGCAGGG + Intergenic
1055766984 9:79674005-79674027 TGGGAGGACTAAAGAGGGCAAGG - Intronic
1056667959 9:88597021-88597043 TGAGATGCCCAAACAGGGCATGG - Intergenic
1057212922 9:93210289-93210311 AGGGATGGGCAGGGTGGGCAGGG + Intronic
1061012421 9:127963517-127963539 TGGGATGGCCACAGTGGCTGTGG - Intronic
1061425459 9:130495591-130495613 TGGAAGGGCAAAAGTGGCCAGGG + Intronic
1061952172 9:133942763-133942785 TAGGGTGGCCAGAGTGGCCACGG - Intronic
1186346938 X:8703279-8703301 TGGGGTTCCAAAAGTGGGCATGG + Intronic
1187953747 X:24495634-24495656 TGGTGTGCCCAGAGTGGGCATGG - Intronic
1190332359 X:49243534-49243556 AGGGAGGGACAAAGTGGGGAAGG - Intronic
1191160307 X:57322974-57322996 TGGGGTGGGGAAAGTGGGGAAGG - Intronic
1191780459 X:64858659-64858681 GGTGATGGCCCAAGTGGACAGGG - Intergenic
1191929352 X:66351944-66351966 TGGGATGGGGAGAGTGGGGAGGG + Intergenic
1192669629 X:73126553-73126575 TGGGATGACAAAAGTGTGCAAGG + Exonic
1196439176 X:115702918-115702940 TGGTTTGGCCAAAGTGGAAATGG - Intergenic
1197271139 X:124425921-124425943 TGGGATGGCAACAATGGGTATGG + Intronic
1197421588 X:126241759-126241781 TGGGATGGCGGAAGGGGGGAGGG + Intergenic
1198987061 X:142466772-142466794 TGGGGTGGGGAAAGTGGGGAGGG + Intergenic
1199850366 X:151721641-151721663 TGGGATGCCCCAAATGGGCAGGG - Intronic
1200049598 X:153421749-153421771 TCTGATGGCCAAAGAGGTCAGGG - Intergenic