ID: 1182649203

View in Genome Browser
Species Human (GRCh38)
Location 22:31836954-31836976
Sequence CAGAACTGCCTCACGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182649203_1182649212 29 Left 1182649203 22:31836954-31836976 CCCTGTTACGTGAGGCAGTTCTG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1182649212 22:31837006-31837028 CTTCTGTTGCACAGTTGGAGTGG 0: 1
1: 0
2: 4
3: 14
4: 130
1182649203_1182649211 24 Left 1182649203 22:31836954-31836976 CCCTGTTACGTGAGGCAGTTCTG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1182649211 22:31837001-31837023 CCAGGCTTCTGTTGCACAGTTGG 0: 1
1: 0
2: 3
3: 35
4: 260
1182649203_1182649205 6 Left 1182649203 22:31836954-31836976 CCCTGTTACGTGAGGCAGTTCTG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1182649205 22:31836983-31837005 TCTGCTCCCCCTGTAGTGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182649203 Original CRISPR CAGAACTGCCTCACGTAACA GGG (reversed) Intronic
902079457 1:13811410-13811432 CAGCACTGCCTCCAGTTACAAGG - Intronic
904882925 1:33714363-33714385 CAGAACTGCCTGATGAAGCAGGG + Intronic
910832342 1:91473610-91473632 AAGACCTGCCCCACGTATCATGG + Intergenic
918304716 1:183235437-183235459 CAGAACTGACTCAAATTACATGG - Intronic
923946504 1:238894106-238894128 CAGATCTTCCTCACGTAAATCGG - Intergenic
1063804023 10:9616732-9616754 CAAAACTGTCTCAGGTAATATGG + Intergenic
1065123725 10:22553024-22553046 CAGAATTACCTCATGTGACAGGG + Intronic
1065169901 10:23016470-23016492 CAAAACTACCTCAGGAAACAGGG - Intronic
1067141187 10:43658583-43658605 CAGGACTGACTCACGGAAAAGGG - Intergenic
1076446555 10:130518175-130518197 CTGAAATGCCTCAGGTACCAAGG - Intergenic
1095707908 12:45257607-45257629 GGGAACTGCCTCAGGAAACATGG - Intronic
1104645977 12:130497495-130497517 CAGAACTGTCTCACGGGCCATGG + Intronic
1107116783 13:36755656-36755678 CAGAACTGGCACACATAAAAGGG + Intergenic
1112143871 13:96676058-96676080 CAGAACTGCTTCTTGGAACAGGG + Intronic
1113753906 13:112795366-112795388 CAGAACTTCCTCGTGTAACATGG + Intronic
1115682415 14:35756163-35756185 CACAACTGTCTCACATAAGAAGG + Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1130903127 15:88222091-88222113 CTGTACTGCCTCACCCAACATGG - Intronic
1132956231 16:2595418-2595440 CAGAACTGCCTCCCGAAAGGTGG - Intronic
1138155465 16:54698861-54698883 GAGAACTGAGTCAAGTAACATGG - Intergenic
1138945359 16:61842734-61842756 CAGTACTGCCCTACTTAACAGGG + Intronic
1140921297 16:79541379-79541401 CATGACTGCCTCACTCAACAAGG - Intergenic
1143664705 17:8350452-8350474 GAAAACTGCCTTATGTAACAGGG + Intergenic
1143874266 17:9979913-9979935 CAGAACTGCCTGCTGTCACACGG + Intronic
1145264410 17:21372790-21372812 CTGAACTGCCTCACGTGCAAGGG - Intergenic
1157125321 18:44950962-44950984 CATAACTGCCTCTCGAAGCATGG - Exonic
1157249938 18:46086027-46086049 CAGAGCTGCATCACATATCACGG - Intronic
1163812584 19:19442993-19443015 CAGAACTGCCTAGGGTGACAGGG + Intronic
925545103 2:5007236-5007258 CAGAAGTGCCTAAGGAAACATGG + Intergenic
927994101 2:27470634-27470656 TAGAACTGCCTCTCCTATCAGGG + Intronic
928042276 2:27890533-27890555 GTGCACAGCCTCACGTAACAGGG + Exonic
931092161 2:58897863-58897885 CAGAACTGCCAAACGGAAGAAGG - Intergenic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
937107654 2:119333142-119333164 AGGAACTGCCTCACGTGATAAGG + Intronic
937271104 2:120653555-120653577 AAGAACTTCCTTAGGTAACATGG - Intergenic
940345076 2:152620528-152620550 CAGAATTACCCCACGTCACAGGG - Intronic
947797026 2:232901174-232901196 CTGAACTGCCTTAAGTAACAGGG - Intronic
1171485118 20:25480742-25480764 CAGAACTGCCTCTCAGAACTTGG - Intronic
1182649203 22:31836954-31836976 CAGAACTGCCTCACGTAACAGGG - Intronic
1185365665 22:50435620-50435642 CAGAGCTTCCTCACCTTACACGG - Intronic
957889585 3:86339136-86339158 CAAAACTGCCTCAACTAAAAAGG - Intergenic
958702479 3:97611816-97611838 CAGAACTTATTCACATAACATGG - Intronic
960088274 3:113613581-113613603 CACAACTGGCTCAAGTAACTGGG - Intronic
964715405 3:159715843-159715865 GAGAACTTCCTCACCTAGCAAGG + Intronic
967548100 3:190756609-190756631 GAGATCTGCCTCACGAAAAATGG - Intergenic
982823241 4:159970565-159970587 CAGAACTCTCTCACTTCACAGGG + Intergenic
983091063 4:163503212-163503234 CAGGCATGCCTCACTTAACAGGG - Intronic
984499944 4:180546372-180546394 CAGAACTGCTTGAGGGAACACGG - Intergenic
987567559 5:19612572-19612594 TAGAACGGCCTTACATAACATGG - Exonic
1006552538 6:34836509-34836531 CAGCACTGCCTCAAACAACAGGG - Intronic
1010083679 6:71890903-71890925 CTAAACTGACTCACATAACATGG + Intronic
1010724613 6:79319233-79319255 GAGATCTGCCTCACATAATATGG - Intergenic
1025236893 7:57240567-57240589 CAGATCTTCCTGACATAACATGG - Intergenic
1035697921 8:1614327-1614349 CAGAACTGACTCAGTGAACACGG + Intronic
1041700870 8:60787766-60787788 CAGATCTGCCAGAAGTAACATGG - Intronic
1042789497 8:72588065-72588087 CAGAACTGGCTCTGGAAACATGG + Intronic
1048288056 8:133157834-133157856 CAGAATTGCCTCACTCAAGATGG - Intergenic
1048547108 8:135397455-135397477 CAGAACTGGCTCAGCTTACACGG - Intergenic
1048857116 8:138694917-138694939 GAGAACTGCCCCTCGTCACAGGG + Intronic
1053789912 9:41679642-41679664 CACAACTGCGTCCCGAAACAAGG + Intergenic
1054155227 9:61635115-61635137 CACAACTGCCTCCCGAAACAAGG - Intergenic
1054178251 9:61891331-61891353 CACAACTGCGTCCCGAAACAAGG + Intergenic
1054475019 9:65566223-65566245 CACAACTGCCTCCCGAAACAAGG - Intergenic
1054659278 9:67689493-67689515 CACAACTGCGTCCCGAAACAAGG - Intergenic
1054717079 9:68567237-68567259 CAGAACTGACTCTGGTTACAGGG - Intergenic
1061117630 9:128624661-128624683 CAGAACTGCCACCCGGAACTGGG + Intronic
1061346849 9:130033332-130033354 CAGCACTGCCTCACTCAACTGGG + Intronic
1062240446 9:135534738-135534760 CAGAGCGGCCCCACATAACATGG - Intergenic
1188301380 X:28507982-28508004 GAGAACTGACTCATGTACCAAGG - Intergenic
1195524462 X:105870737-105870759 CATAACTGCCTCAAATTACAGGG + Intronic
1198720956 X:139619647-139619669 CAGAACTGGCTGATGTAACAGGG - Exonic
1199504360 X:148544609-148544631 CAGAATTGCCCTACATAACAAGG - Intronic