ID: 1182649614

View in Genome Browser
Species Human (GRCh38)
Location 22:31840531-31840553
Sequence CAGCTATTCCAGAGAACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182649614_1182649617 -5 Left 1182649614 22:31840531-31840553 CCTGTTGTTCTCTGGAATAGCTG 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1182649617 22:31840549-31840571 AGCTGGTGGATGTCCCTCAGTGG 0: 1
1: 0
2: 0
3: 9
4: 146
1182649614_1182649621 28 Left 1182649614 22:31840531-31840553 CCTGTTGTTCTCTGGAATAGCTG 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1182649621 22:31840582-31840604 TCTGTGTCCAGTTCTGTTCCTGG 0: 1
1: 0
2: 2
3: 36
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182649614 Original CRISPR CAGCTATTCCAGAGAACAAC AGG (reversed) Intronic
900308660 1:2023128-2023150 CCGCAATTCCAGAGAAACACTGG - Intronic
900711190 1:4115484-4115506 CAAGGGTTCCAGAGAACAACTGG - Intergenic
901940380 1:12657316-12657338 TAGTAATTCCAGAGAACAAGAGG + Intronic
902759410 1:18571446-18571468 CAGCTATTCAGGAGACCAAGAGG + Intergenic
905120147 1:35675599-35675621 CAGTTATTCTTGAGAACTACAGG - Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
909753729 1:79196404-79196426 CAGGTCTTCCAGAGAACAGCAGG + Intergenic
910558650 1:88565809-88565831 CTGTTATCCCAGAAAACAACTGG - Intergenic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
913554190 1:119948657-119948679 GAGCTATTCCACAGACAAACTGG + Intronic
915146942 1:153800905-153800927 CAGCCAGCCCAGAGAACCACAGG - Intergenic
917165827 1:172111998-172112020 CAAATATTCCAGAGAATGACAGG - Intronic
917932539 1:179833068-179833090 CAGCTATTCCAGAGACTGAGGGG + Intergenic
922953798 1:229582127-229582149 CAGGGATTCAAGAGCACAACCGG - Intergenic
1062821734 10:539828-539850 CAGCTATATCATAGAATAACAGG + Intronic
1065368948 10:24963127-24963149 CACCTTTTCCAGAGAATAAAGGG + Intergenic
1066318903 10:34279662-34279684 CAGGTATTACTGAGAACAGCTGG + Intronic
1067433909 10:46264228-46264250 CTGCGATTCCAGAGACCTACAGG + Intergenic
1067439782 10:46302086-46302108 CTGTGATTCCAGAGAACTACAGG - Intronic
1067581934 10:47451668-47451690 CTGCGATTCCAGAGACCTACAGG - Intergenic
1067990601 10:51207548-51207570 TAGCCATTCCAGAGATCTACTGG + Intronic
1070418898 10:76216774-76216796 CAGCAATTCCACTGTACAACAGG + Intronic
1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG + Intergenic
1077822164 11:5756844-5756866 TAGCAATTTCAGATAACAACTGG - Intronic
1080205338 11:29723024-29723046 CTGCTATTACACAGAGCAACTGG + Intergenic
1086433597 11:86759530-86759552 CATATATTCCAGAGAACATATGG - Intergenic
1086495470 11:87400094-87400116 AAGCTAAACCAGAGAACTACTGG - Intergenic
1087726811 11:101727995-101728017 CTGCTGTTTCAGAGAAGAACTGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1090404499 11:126468637-126468659 CAGCTATTTCATAAAACACCAGG - Intronic
1093924530 12:24896276-24896298 TACCTAGTCCAGAGGACAACGGG - Intronic
1095540722 12:43305730-43305752 CAGTTATCCCAGAGAAAAATAGG + Intergenic
1096909357 12:54966611-54966633 CAGATATGCCAGAGAGTAACTGG + Intronic
1098766083 12:74490946-74490968 GTGCTATTACAGAGAACAAGGGG + Intergenic
1098890764 12:76008458-76008480 CCGCTATACCAGATAATAACTGG - Intergenic
1099590076 12:84575591-84575613 CAGAAAATCCAGAGAACCACAGG + Intergenic
1100444987 12:94651617-94651639 CAGCTGTTCCAGAGAGGACCTGG + Intergenic
1104186462 12:126436760-126436782 CAGCTACTCTAGAGATCAAAAGG + Intergenic
1104844564 12:131840383-131840405 CATCTATCCCAGTGAACTACTGG + Intronic
1106450380 13:29876333-29876355 CAACTTTTACAGAGATCAACTGG + Intergenic
1106465889 13:30014170-30014192 AAGCTTTACCAGAGAACAGCTGG + Intergenic
1107995790 13:45859797-45859819 AAGCCATTCAGGAGAACAACAGG - Intergenic
1108836157 13:54552067-54552089 CAACAAGTCCAGAGAACAACAGG - Intergenic
1109330852 13:60927901-60927923 CTGCTATTCTAGAAAACATCTGG + Intergenic
1109623423 13:64941442-64941464 CTGCTACTCAAGAGAACATCAGG + Intergenic
1110485140 13:76030711-76030733 TAGCTACTCCAGAAAACAAAGGG - Intergenic
1111583580 13:90255539-90255561 CAGATATAACAGATAACAACTGG - Intergenic
1112327742 13:98454461-98454483 CATCTCTCCCAGAGAACAAATGG + Intronic
1113149266 13:107243399-107243421 CAGCTGTGCCAGGGAACAATGGG - Intronic
1116376070 14:44202549-44202571 CAGGTATTCAAGAGAAAGACTGG - Intergenic
1117133706 14:52711964-52711986 CTGCCATTCCAGAAAACCACTGG + Intronic
1117296610 14:54386190-54386212 CAGCGAATCCAGAACACAACAGG - Intergenic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1118817194 14:69321960-69321982 CAGCTACTCCACAGCACAAAGGG + Intronic
1120063924 14:80017739-80017761 CAGGAATTCCAGAGAAGAAAAGG - Intergenic
1120455197 14:84720773-84720795 CAGGAAATCCAGAGAACACCTGG + Intergenic
1120529512 14:85615047-85615069 AAGCTATTCCTGATAGCAACTGG - Intronic
1202832195 14_GL000009v2_random:47123-47145 CAGCCACTATAGAGAACAACAGG - Intergenic
1123997250 15:25727430-25727452 CAGCTCTTGCAGAGACCCACAGG - Intronic
1124071093 15:26393739-26393761 CAGCTTTTCCAATGAACAATGGG - Intergenic
1125137398 15:36359435-36359457 CAGCTATGCCAAAGAAAAGCTGG + Intergenic
1125756841 15:42070470-42070492 CACCTACTCCAAAGAACAGCTGG - Intronic
1131632248 15:94190563-94190585 CTGCTATTTGATAGAACAACAGG + Intergenic
1135610946 16:23866749-23866771 CAGCTATTCTGGAGAACATTTGG - Intronic
1155142692 18:23057160-23057182 CAGATATTCCAGAGCAAATCAGG - Intergenic
1155881029 18:31148878-31148900 CAGTTAATTCAGAGAACAACTGG - Intronic
1157684127 18:49629230-49629252 CAGCTACTCAAGGGAACAATTGG + Intergenic
1158613025 18:58960502-58960524 CAGCCATTTCAGAGAACAGATGG + Intronic
1158791161 18:60782208-60782230 CAGTTACTCAAGAGAACTACAGG + Intergenic
1159611318 18:70528423-70528445 AAGTTATTCCTGAGGACAACAGG + Intergenic
1161737971 19:6003149-6003171 CAGCCCCTCCAGAGAACCACAGG - Intronic
1162420228 19:10561915-10561937 CAGCTATTCCAAGCAACAGCTGG + Intronic
1164451997 19:28374330-28374352 CATCAACTCCAGAGAATAACTGG - Intergenic
1164774408 19:30841633-30841655 CAGCTGTTAAAGAGAATAACGGG + Intergenic
1165981947 19:39731929-39731951 GAGCAATTCCAGAGAGAAACTGG - Intronic
1166199216 19:41225933-41225955 CAGCTTTTCCAGAGAATGAGAGG - Intronic
1167207239 19:48110813-48110835 CAGCTGTTCCAGAGCTCACCCGG + Exonic
1202640491 1_KI270706v1_random:80648-80670 CAGCCACTATAGAGAACAACAGG + Intergenic
929018501 2:37526348-37526370 CCTCTAGTCCAGAGAACAACTGG + Intergenic
929963310 2:46512810-46512832 CAGCTATACCAGTGAACAAGAGG + Exonic
930975121 2:57448973-57448995 CAGTCATTCTAGAAAACAACTGG + Intergenic
931328861 2:61258453-61258475 CATCTATTCCACAGATTAACCGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932088300 2:68782026-68782048 CAGCTATTCCAGAGCAAATCAGG - Intronic
932733226 2:74235151-74235173 CATCGATTCCACAGAACATCAGG + Exonic
934547631 2:95231872-95231894 CAGCTGCTCCAGAGAGCACCAGG - Intronic
934550581 2:95259001-95259023 AAGCGATTGCAGAGAATAACTGG + Intronic
935292449 2:101621772-101621794 GAGCTCTTCCAGAGAAGAGCTGG + Intergenic
935975232 2:108571893-108571915 CTGCTCTTCCAGAGCTCAACTGG + Intronic
937235476 2:120429521-120429543 AAGAGATTCCACAGAACAACTGG - Intergenic
937296730 2:120814005-120814027 CAGCTGCCCCCGAGAACAACTGG + Intronic
940033696 2:149291153-149291175 CTGCTGTTCCAGAGACCAACTGG + Intergenic
940564255 2:155340210-155340232 CAGCTAATCTAGAGGACAACTGG - Intergenic
943597170 2:189872219-189872241 CATTTTTCCCAGAGAACAACTGG - Intronic
947284430 2:228496693-228496715 CAGCCATTCCAGGGACAAACTGG + Intergenic
947410155 2:229829204-229829226 CAGCTTTTCCATAGAACAATTGG - Exonic
948074558 2:235155862-235155884 CAGCAATTCCAGAGGACACCCGG + Intergenic
1169146607 20:3256743-3256765 CAGCTATTCCAGCAACCACCAGG - Intronic
1169366721 20:4998555-4998577 AAGCAAGCCCAGAGAACAACTGG + Intronic
1172330459 20:34072355-34072377 CAGCTATTCTAGAGAATACTAGG - Intronic
1173876093 20:46372716-46372738 CAACTATTAAAGAAAACAACAGG + Intronic
1173928959 20:46802511-46802533 CAGCCATTCTAAAGAACAGCAGG - Intergenic
1180361453 22:11901233-11901255 CAGCCACTATAGAGAACAACAGG - Intergenic
1181808945 22:25391911-25391933 CAGCTATTCCAGAAAACCTCGGG + Intronic
1182313731 22:29427833-29427855 CTGCTCTTACACAGAACAACAGG - Intergenic
1182509331 22:30807764-30807786 CAGCTATTCAAGGGACCAGCTGG + Intronic
1182649614 22:31840531-31840553 CAGCTATTCCAGAGAACAACAGG - Intronic
1183783173 22:40011942-40011964 CAGCTATTCTGTAGAGCAACAGG - Intronic
1184950142 22:47835744-47835766 CAGCCACTCCGGAAAACAACCGG + Intergenic
949433726 3:4005855-4005877 CAACCATTCCAAAGAAAAACAGG + Intronic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
951196060 3:19824944-19824966 GAGCCATTCCAGAGAAGAAAAGG + Intergenic
954588196 3:51755379-51755401 CAGGAAATTCAGAGAACAACAGG - Intergenic
955603923 3:60678641-60678663 CAGTTATCCAAGAGAAAAACTGG + Intronic
956565465 3:70632197-70632219 CAGCTATTCAGGAGAATAGCTGG - Intergenic
957876267 3:86150342-86150364 CAAATTTTCCAGAGAACAATGGG - Intergenic
958177621 3:90016678-90016700 CAGGTATTCCAGAGGATACCTGG - Intergenic
959597584 3:108144777-108144799 CACCTGTTACAGAGAACACCAGG - Intergenic
960221842 3:115121367-115121389 CAGCTACTCCAGAAAAAAAAAGG - Intronic
960286793 3:115838977-115838999 AAGCCAATCCAGAGAAGAACAGG - Intronic
961583596 3:127903519-127903541 CATCTCTTTCACAGAACAACAGG - Intergenic
962257742 3:133883971-133883993 CAGCTGGCCCAGAGAAAAACTGG - Intronic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
963718482 3:148832567-148832589 CAGCTACCACAGAGGACAACTGG + Intronic
965470045 3:169079557-169079579 CAGCTATTCCACAAGAGAACTGG - Intergenic
966801803 3:183771097-183771119 CAGCCATTCCAGAGAGGCACTGG - Intronic
968166453 3:196469850-196469872 CTGCTATTCCAGAAAAAAATGGG - Exonic
1202738064 3_GL000221v1_random:26754-26776 CAGCCACTATAGAGAACAACAGG - Intergenic
973795429 4:54420742-54420764 CAACTATTCAAGAGAATCACAGG - Intergenic
977262223 4:94811465-94811487 CAGCTATTCGAGCAAACAGCAGG - Intronic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
981177486 4:141699342-141699364 AAGCTATACCATAGAACAAATGG - Intronic
982081009 4:151790075-151790097 CAACATTTCCTGAGAACAACTGG + Intergenic
984337728 4:178414977-178414999 CAGCTATTCCAGAGAGCGCAGGG - Intergenic
984698345 4:182801158-182801180 CAGCTATAACAGATAACAAAAGG - Exonic
985708789 5:1416461-1416483 CAGCGATTCCACAGAACCAGAGG + Intronic
987810866 5:22834141-22834163 CACCTATTCCAGAGGAAAAGAGG - Intronic
988139888 5:27223400-27223422 CAGAGATACCAGAGATCAACAGG - Intergenic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
993566163 5:89477997-89478019 CAGAAACTCCAGAGGACAACAGG + Intergenic
994350848 5:98743943-98743965 CAGGAAATCCAGAGAACTACAGG + Intergenic
995830215 5:116346916-116346938 CAGATAGTCCAGAGAACCCCTGG - Intronic
996257213 5:121418947-121418969 CTGCTATTTCATAGCACAACAGG - Intergenic
998640256 5:144002257-144002279 CAGCTATTCCAGGACACACCGGG - Intergenic
1000419023 5:161015810-161015832 CTTCTATTCCAGAAAACATCAGG - Intergenic
1005283766 6:24302673-24302695 CTGCTATTAGAGAGAACCACGGG + Intronic
1005838006 6:29722671-29722693 CAACTTTTCCAGAGAAGAAGAGG + Intergenic
1010511480 6:76725988-76726010 CAACTTTGCCAGAGAACAATGGG - Intergenic
1011320992 6:86093237-86093259 AAACTATACCAGAGAACAAATGG - Intergenic
1012067579 6:94568074-94568096 CATCTTTTCCAGAGAAAAATGGG - Intergenic
1013016813 6:106167471-106167493 CAGTTAGTACAGAGAACAACAGG - Intergenic
1015048727 6:128812871-128812893 CAGCTATACCCTAGAACAAATGG - Intergenic
1016079888 6:139843260-139843282 CAGGTTTTTCTGAGAACAACGGG - Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1017572689 6:155764341-155764363 TAGCCATTCTCGAGAACAACTGG + Intergenic
1018408654 6:163517230-163517252 CAGATATTCCAAACACCAACTGG - Intronic
1018643343 6:165925388-165925410 CAGCTATGCCAGAGAAATAAAGG + Intronic
1019207054 6:170370493-170370515 CAGATCTTCCAGAGCACGACTGG - Intronic
1025238091 7:57248434-57248456 CAGCTATAACAGTGAACAAATGG + Intergenic
1027454019 7:78365035-78365057 CAGCTATTTTAGAAAACAATGGG - Intronic
1029213538 7:98928605-98928627 CAGCTATGGCAGAGAACAGTCGG - Intronic
1029292800 7:99515495-99515517 CAGCTATTCCACTGAGCTACTGG - Intronic
1030211335 7:106998868-106998890 CAACTATTCCACAGCACAAGAGG + Intergenic
1031584448 7:123517646-123517668 CAGAAATTCTAGAGAACCACAGG + Intronic
1032350802 7:131161498-131161520 CAGCAATAGCAGAGAACAGCAGG - Intronic
1034335675 7:150322145-150322167 CACCTAACCCAGAGAACATCTGG - Intronic
1034755104 7:153609531-153609553 CACATTTTCCAGAGAAAAACTGG - Intergenic
1034994112 7:155567278-155567300 CAGCCATTACAGAAAACAGCGGG + Intergenic
1038364171 8:26914381-26914403 CAGCTCTTCCAAAGAACAGCTGG + Intergenic
1039185130 8:34908184-34908206 CAGCTTTTCCTGAGAACAGCTGG + Intergenic
1040582174 8:48707138-48707160 CAGCTATTCCAGGGCAGGACTGG - Intergenic
1043027447 8:75087777-75087799 CATCTATTCCAGAAAGAAACAGG - Intergenic
1043747034 8:83887366-83887388 CTGCTATTTCATAGCACAACAGG - Intergenic
1046169971 8:110492576-110492598 CAGCTAATCCTCAGAACAACTGG - Intergenic
1046338062 8:112815618-112815640 CAAATATTCCTGAGAACAAAAGG + Intronic
1048583737 8:135753067-135753089 CTGCTATTACAGAGAACAAAGGG - Intergenic
1048964413 8:139604916-139604938 CAGCTGTCCCAGAGATTAACGGG - Intronic
1050323450 9:4477526-4477548 CAGCTACTCCAGAGACCGAGGGG - Intergenic
1051122372 9:13765264-13765286 TAGCTATTACAGGGAAGAACGGG + Intergenic
1053201310 9:36153380-36153402 GTGCTATTCCAGATACCAACAGG + Intronic
1060577197 9:124707423-124707445 CAGATATTCCAGAGAAATAAAGG - Intronic
1203692266 Un_GL000214v1:55413-55435 CAGCCACTATAGAGAACAACAGG + Intergenic
1203706793 Un_KI270742v1:57198-57220 CAGCCACTATAGAGAACAACAGG - Intergenic
1203556452 Un_KI270744v1:2305-2327 CAGCCACTATAGAGAACAACAGG + Intergenic
1203644029 Un_KI270751v1:48778-48800 CAGCCACTATAGAGAACAACAGG - Intergenic
1187055584 X:15738632-15738654 CAGCTGTTCCAGAGAAAAGGGGG + Intronic
1187102316 X:16206623-16206645 AAGGTGCTCCAGAGAACAACTGG - Intergenic
1188683047 X:33035326-33035348 CAGCTATGCCAGAGAAAGCCAGG + Intronic
1192596739 X:72417405-72417427 CAGCAATTCTAGACACCAACAGG + Intronic
1193478555 X:81997349-81997371 CAGCAAATCCAGAGAACTGCAGG + Intergenic
1197164706 X:123364197-123364219 CAGAAATTCCATAGCACAACAGG + Intronic
1197721917 X:129750992-129751014 CAGATATTCCAGGGACCCACTGG + Intronic
1198125093 X:133635998-133636020 CAGGTATTCCAGGGCTCAACAGG - Intronic
1198170454 X:134100202-134100224 AGGTTCTTCCAGAGAACAACTGG + Intergenic
1198186874 X:134261555-134261577 CTGCTATTCGATAGCACAACAGG + Intergenic
1199424411 X:147684245-147684267 AAACTATTCCATAGAACAAATGG + Intergenic
1199822383 X:151462291-151462313 CAGCTATTTCAAAGAGCAAAAGG - Intergenic
1199914525 X:152325016-152325038 AAGCTATCTCACAGAACAACAGG - Intronic
1200103715 X:153701087-153701109 CAGCTATTCAAGTGAACAAGGGG + Intronic
1200697963 Y:6377716-6377738 CAGGGATTCCAGAGAGCAAAAGG - Intergenic
1200708524 Y:6463474-6463496 CAGCTATTTAAGAGAGCAAAAGG - Intergenic
1200927041 Y:8663974-8663996 CAGGTATTTCAGAGAGCAAAAGG + Intergenic
1201025588 Y:9701234-9701256 CAGCTATTTAAGAGAGCAAAAGG + Intergenic
1201036149 Y:9786983-9787005 CAGGGATTCCAGAGAGCAAAAGG + Intergenic
1201372197 Y:13278038-13278060 CAGCTCTGCCAGAGTAGAACAGG + Intronic