ID: 1182651373

View in Genome Browser
Species Human (GRCh38)
Location 22:31853981-31854003
Sequence CAGCCTACACAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182651373_1182651379 13 Left 1182651373 22:31853981-31854003 CCTTCCTGCTTCTGTGTAGGCTG 0: 1
1: 0
2: 2
3: 28
4: 287
Right 1182651379 22:31854017-31854039 CCCACCCTTTAAGGCCCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 106
1182651373_1182651375 4 Left 1182651373 22:31853981-31854003 CCTTCCTGCTTCTGTGTAGGCTG 0: 1
1: 0
2: 2
3: 28
4: 287
Right 1182651375 22:31854008-31854030 TTCCTCCTGCCCACCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182651373 Original CRISPR CAGCCTACACAGAAGCAGGA AGG (reversed) Intronic
900032642 1:382054-382076 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
900053400 1:611116-611138 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
900079968 1:848987-849009 GGGCCTACACTGAAGCAGAAAGG + Intergenic
900118197 1:1037475-1037497 CAGCCTACCCAGGACCAGGAAGG + Intronic
900251367 1:1671906-1671928 GAGCGTTCACAGAATCAGGAAGG - Intronic
900354242 1:2252403-2252425 CAGCCTCCCCAGAAGCAGCTTGG + Intronic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
902058581 1:13622609-13622631 CAGCTTGCAGAGAACCAGGAAGG - Intergenic
902074846 1:13776160-13776182 CAAGCCACACACAAGCAGGAAGG - Intronic
902520590 1:17013439-17013461 CAGCCTCCAGGGCAGCAGGAAGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904615611 1:31747975-31747997 AAGCCCACACAGGAGCTGGATGG - Intronic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
905110275 1:35589729-35589751 CAGCCAAGACAGAGGCAGGGGGG - Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910638605 1:89437080-89437102 CAGCCAACTCAGAAGCGGGCAGG - Intergenic
912274110 1:108238705-108238727 CAGCCTAGACAGAGCTAGGAGGG + Intronic
912287157 1:108381157-108381179 CAGCCTAGACAGAGCTAGGAGGG - Intronic
912294109 1:108455618-108455640 CAGCCTAGACAGAGCTAGGAGGG - Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
914381140 1:147117544-147117566 CAGCCTAGACAGAGGTATGAGGG + Intergenic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
914873489 1:151494807-151494829 CTGCCTATATGGAAGCAGGAGGG - Intergenic
915487022 1:156228662-156228684 CAGCCTACTCAGCAGGCGGAGGG - Intronic
916610947 1:166390936-166390958 CCTCCCACTCAGAAGCAGGAGGG + Intergenic
916724676 1:167512224-167512246 CAGCCGACGCACAAGCAGAAGGG + Intronic
916865218 1:168849192-168849214 CACCTTACACAAAAGCAGAAGGG - Intergenic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920335386 1:205241792-205241814 CAGCCTGCACAGCAGCAGTGGGG + Exonic
920742779 1:208597288-208597310 CAGCCTCCAGAGAAGAAGGCTGG + Intergenic
920748590 1:208652451-208652473 CAGCCTACAGCGAAGAAGGCCGG - Intergenic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
924581715 1:245329564-245329586 CAGCCACTGCAGAAGCAGGACGG - Intronic
1063187080 10:3661054-3661076 CAGCCTACAGGGAAGGGGGAAGG - Intergenic
1066356457 10:34688974-34688996 GAGCCTAAATAGCAGCAGGAGGG + Intronic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068332722 10:55592378-55592400 CAGCATTCCTAGAAGCAGGAGGG - Intronic
1068353497 10:55880893-55880915 CAGCCTGCACAGAGCCAAGAAGG + Intergenic
1068839169 10:61590944-61590966 CAGCTCACACTGAAGCAGTAGGG - Intergenic
1069380717 10:67841073-67841095 AAGCCTACCCAGAAGCTGAACGG + Intergenic
1069829491 10:71273826-71273848 CAGACTTGCCAGAAGCAGGAAGG + Intronic
1075680131 10:124325593-124325615 CAGCCTATACAAAGGCTGGAAGG - Intergenic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076517636 10:131057126-131057148 CACCCTCCCCAGCAGCAGGAGGG + Intergenic
1076817107 10:132920450-132920472 CAGCCAGCAGAGCAGCAGGAGGG - Intronic
1077196772 11:1284955-1284977 CATCCTGCACAGATGCAGAAAGG - Intronic
1077242090 11:1515901-1515923 CAGCCTTCACAGAGGCACGAGGG + Intergenic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1077951262 11:6960414-6960436 CAGCCTACAAAGAGGAAGAAAGG + Intronic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079478619 11:20858023-20858045 CAGCTTACCCAATAGCAGGATGG + Intronic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1081305396 11:41505535-41505557 GAAGCTACACAGAAACAGGAAGG - Intergenic
1082896938 11:58201774-58201796 TAGCCCATACAGAAGCAGGTGGG + Intergenic
1083922757 11:65789337-65789359 GAGCCTACAGAGAAGCCGGCAGG - Intronic
1084265815 11:68004594-68004616 CAGCCCAAACTGGAGCAGGATGG - Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1094659513 12:32453601-32453623 CATCCTACAGAGAAGCAAAATGG + Intronic
1095482163 12:42647971-42647993 CAGCCTTCAAAGACGAAGGAAGG - Intergenic
1095818441 12:46450485-46450507 CAGCCTCTACAGAAGCAGTGGGG - Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096255798 12:50061573-50061595 CACCCAACACACAAGCAGGAGGG + Intronic
1096568001 12:52497108-52497130 CAACATAGACAGAAGCACGAAGG + Intergenic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1101860611 12:108479451-108479473 CTGCCTACACAGCAGCAGGAAGG + Intergenic
1102484117 12:113244555-113244577 CAGCCGGCACAGAAGCATGGTGG + Intronic
1102855689 12:116291233-116291255 TTGACTACAAAGAAGCAGGAGGG - Intergenic
1102879487 12:116473469-116473491 CACCCTACAGAGCAGCTGGAGGG + Intergenic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1104044334 12:125151319-125151341 AAGCCTACGCAGAAGGAAGAAGG - Intergenic
1104133464 12:125916434-125916456 CATCCAACACAGAAGAACGAAGG - Intergenic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107541680 13:41394709-41394731 CAGCCTTCCCAGAGGCAGTATGG - Intergenic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1110209225 13:72953030-72953052 CAGCCTTGACAGAAGCAGCTGGG + Intronic
1114365993 14:22027482-22027504 CAGCCTTGACAGAAGCAGCTGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117288302 14:54308574-54308596 CAGCCCACACATAAGAGGGAGGG + Intergenic
1118812496 14:69285521-69285543 CATCACACACGGAAGCAGGATGG + Intronic
1119706004 14:76782979-76783001 CAGCCTACACAGCAGGAGCTGGG - Exonic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1122048734 14:99041161-99041183 CGGCCTCCACAGATGCATGAAGG - Intergenic
1124720039 15:32104016-32104038 GAGGCAACACTGAAGCAGGAAGG - Intronic
1126462149 15:48925827-48925849 CAGCCCACACTGAAGAGGGATGG + Intronic
1126629416 15:50718882-50718904 CAACTGACACAGAAGCATGAGGG + Intronic
1127495365 15:59506270-59506292 CAGCCTCCCAAGCAGCAGGAGGG + Intronic
1127882805 15:63173005-63173027 CAGACAACAGAGGAGCAGGAAGG - Intergenic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1129855449 15:78821438-78821460 CAGTCCAGACAGAAACAGGAAGG + Intronic
1130119874 15:81038587-81038609 CAGCACTGACAGAAGCAGGAGGG + Intronic
1130233521 15:82114190-82114212 GAGCCTACTCAGGAGGAGGAAGG + Intergenic
1130561827 15:84964902-84964924 CTGCCAACATAGGAGCAGGAGGG + Intergenic
1130705446 15:86228918-86228940 CAGCCTACATAGACACAGAAAGG - Intronic
1133423737 16:5669295-5669317 CAGCCTACCCAGCAGCAGGAGGG + Intergenic
1135280163 16:21147336-21147358 CAGCCTCCCAAGAAGCTGGATGG + Intronic
1139386530 16:66576067-66576089 CAGCACACAAAGAAGCAGGTTGG + Intronic
1140479390 16:75254217-75254239 CAGCCCACCCTGCAGCAGGAAGG + Intronic
1141454826 16:84134195-84134217 CAGCATATCCAGCAGCAGGAGGG - Intronic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1142129479 16:88426146-88426168 CCGCCTCCACAGAGGCAGCAGGG + Intergenic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143845419 17:9769713-9769735 CTGCCTCCACGGTAGCAGGACGG + Intergenic
1143987676 17:10929141-10929163 GATCCTAAACAGAAGCAAGAAGG - Intergenic
1146367331 17:32239022-32239044 AAGCCTACATTGAAGCAGGAGGG - Intronic
1148138573 17:45311852-45311874 CAGTCAGCAAAGAAGCAGGAGGG - Intronic
1148484026 17:47978996-47979018 CACCCTTCACACAAACAGGAGGG - Intronic
1148519817 17:48262105-48262127 CTGCCTACAAAGAAGATGGAGGG + Intronic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149865389 17:60148662-60148684 GATCCTACAGAGAGGCAGGAGGG - Intergenic
1150467100 17:65403117-65403139 CAGCCTAGGGAAAAGCAGGAAGG - Intergenic
1150569054 17:66369753-66369775 CAGCCAACTCAGATGGAGGATGG - Intronic
1151012260 17:70514396-70514418 CAATCTACACATAAGCAGAATGG + Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153658265 18:7304554-7304576 CACCCCACACAGAGGCATGAGGG - Intergenic
1155170719 18:23265173-23265195 GAGCCTAACCAGAAGCTGGAGGG - Intronic
1155818966 18:30351181-30351203 AGGCCTACACAGCAGCAGGTTGG + Intergenic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1162680114 19:12334058-12334080 CAGGCCACACTGCAGCAGGAGGG + Intergenic
1162683942 19:12366054-12366076 CAAACCACACTGAAGCAGGAGGG + Intergenic
1163262916 19:16201984-16202006 CTTCCTACACAGAAGCCAGACGG - Intronic
1164561700 19:29296800-29296822 CAGCCTCCTCAGCAGAAGGAGGG + Intergenic
1165017207 19:32889877-32889899 CAGCACACACAGCAGCAGAAGGG + Intronic
925204722 2:1996320-1996342 CAGCCCACACTGAGGCAAGACGG - Intronic
925204758 2:1996527-1996549 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204771 2:1996596-1996618 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204812 2:1996799-1996821 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204863 2:1997071-1997093 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
926448886 2:12978229-12978251 CAGCTTGCTTAGAAGCAGGAAGG - Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
928365006 2:30693798-30693820 CAGCCTACAGCCAAGCTGGATGG + Intergenic
932508711 2:72263442-72263464 TAGTCTACACAGTGGCAGGAGGG - Intronic
934146680 2:89101529-89101551 CAGCTTATAAAGCAGCAGGAAGG - Intergenic
934222587 2:90099063-90099085 CAGCTTATAAAGCAGCAGGAAGG + Intergenic
935368734 2:102322301-102322323 CAGGCAACACAAAAGCATGAAGG - Intronic
935389174 2:102532433-102532455 GAGCCTACACAGAGGAAGGAAGG + Exonic
935827593 2:106966990-106967012 AGGCCTAGACAGAAGCAGGGTGG + Intergenic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
937827602 2:126383884-126383906 AGTCCTACACAAAAGCAGGAAGG + Intergenic
939211272 2:139177957-139177979 CAGCCCACTCAGAAGCAGAGGGG - Intergenic
941157496 2:161997131-161997153 CAGCCTGCACAGAAGAGGAAGGG - Intronic
941846321 2:170137987-170138009 CAGCCTATCAAGAAGCAGGTGGG + Intergenic
942544453 2:177048292-177048314 CAGCCTACAGAAAAGCAAGGGGG - Intergenic
942677649 2:178445659-178445681 CAGGCTATACAGAAACAGCATGG + Intronic
943965330 2:194325832-194325854 CACACTACCCAGAAGCAGGATGG + Intergenic
948403432 2:237700938-237700960 AATTCTACACAGAAGCTGGAAGG - Intronic
948596653 2:239083729-239083751 GTGCCCACACAGCAGCAGGAAGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1170089704 20:12577085-12577107 CAGCCCACACCGAAGGAGTAGGG - Intergenic
1171248487 20:23632095-23632117 CAGCCCACAGGGAAGCAGGTTGG - Intronic
1171994936 20:31723656-31723678 CAGCCGGCACGGAAGCGGGACGG + Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1174130478 20:48340561-48340583 CAGGCTACAGAGCAGCAGGGAGG + Intergenic
1175300374 20:57938652-57938674 CATCCTGCACAGAAGCTGGCAGG + Intergenic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1175787077 20:61718437-61718459 CACCCAACACAGAAGGAGGCAGG + Exonic
1175922850 20:62458199-62458221 CCTCCTCCACAGCAGCAGGAGGG - Intergenic
1178947259 21:36959031-36959053 CTGCCAACTCAGAAGCGGGAAGG - Intronic
1179303479 21:40133955-40133977 CAGCCTTCACTGGAGCTGGACGG - Exonic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181090775 22:20471057-20471079 CATCCTGCACATAAGCAGGTAGG - Intronic
1181136113 22:20767579-20767601 CAGCCTTCCCAGTAGCAGGGAGG + Intronic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1182349675 22:29692260-29692282 CTGCCCACACAGAAGTAGGAAGG - Intronic
1182446710 22:30393890-30393912 CAGCTCTCACAGAGGCAGGAGGG + Intronic
1182519548 22:30877686-30877708 CAGGCTGCTAAGAAGCAGGATGG - Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183184737 22:36285483-36285505 CACCCAACACAGAAGCCAGAGGG + Intronic
1183928894 22:41224974-41224996 CAGTCTACACAGAAGGCGGTTGG + Exonic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1185261383 22:49866281-49866303 CAGCCACCCCAGAAACAGGAGGG - Intronic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950547009 3:13644223-13644245 CAGCACTCACAGAAGCTGGATGG - Intergenic
950599863 3:14024293-14024315 CACTCAACACAGAAGCAGGCAGG - Intronic
951197260 3:19838364-19838386 CATCCAACACAGAAGCAGCCAGG + Intergenic
951760890 3:26146510-26146532 CATCATACACAGAAGATGGATGG + Intergenic
953854089 3:46487487-46487509 TAGCCTACCCAGAAAGAGGATGG + Intergenic
953921828 3:46957106-46957128 CAGCCTGCCTTGAAGCAGGAAGG + Intronic
955358346 3:58250547-58250569 TAGCCTTTACAGAAACAGGAGGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
957232315 3:77536220-77536242 CAGGCCACAAAGAAGCAGGTGGG + Intronic
958458309 3:94361175-94361197 CAGCCTACATAGCAGGAGGAAGG + Intergenic
959298875 3:104574035-104574057 CAGCAAACACAGAAACAGGCTGG - Intergenic
960249841 3:115439637-115439659 CAGCCTACATAGTGGGAGGAGGG + Intergenic
966950758 3:184815042-184815064 AGGCCTACACAGAGTCAGGAAGG + Intronic
968814460 4:2814829-2814851 CAGCCGACACCGCAGCAGCATGG + Intronic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
980722617 4:136717507-136717529 CAGCATACACACAGACAGGAAGG - Intergenic
981695932 4:147558655-147558677 CAGTCTAGACTGCAGCAGGAGGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983840473 4:172451572-172451594 CAGCTTATACAGATGCAAGATGG + Intronic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
984801144 4:183718230-183718252 CAGCCTCCAGAGTAGCAGGGGGG - Intergenic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985576168 5:674437-674459 TAGCCCACGCAGAAGCAGGTGGG - Intronic
985685011 5:1277377-1277399 GAGCCTCCACAGCAGCGGGAAGG + Intronic
986460917 5:7971472-7971494 CACCCTCCACTGAAGCAGGCAGG + Intergenic
986496827 5:8350867-8350889 CAGCCCACAGAGAAGCAGGGAGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
991966240 5:72094299-72094321 CAGCCCAAACAGAAACAGCATGG - Intergenic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
994135129 5:96277946-96277968 CAGCCTTCAGAGAAGGGGGATGG - Intergenic
995200638 5:109422006-109422028 CAGCCTGCACCAATGCAGGATGG + Intergenic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
996063734 5:119058995-119059017 CAACATACAGAAAAGCAGGAAGG - Intronic
996473622 5:123888966-123888988 CTCCTTACACAGAACCAGGACGG - Intergenic
998075139 5:139230071-139230093 CAGCCTACACTGAAGGAGTGGGG - Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
999475273 5:151892416-151892438 CAGCCTCCTTAGAAGCAGCAAGG + Exonic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1002741178 5:181436814-181436836 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1003005811 6:2380491-2380513 CAGCCCATTGAGAAGCAGGAGGG - Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1008927020 6:56897754-56897776 CAACCTACCTAGAAGCTGGAGGG - Intronic
1010899159 6:81404289-81404311 GGACCTACACAGAAGGAGGAAGG - Intergenic
1010935956 6:81861623-81861645 GTGCTCACACAGAAGCAGGAAGG + Intergenic
1012592382 6:100998367-100998389 CAGCTTTCCCAGAAGCAGAAGGG - Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1013920546 6:115397042-115397064 CAGCCCACCCAGAAGCTGCATGG - Intergenic
1014992632 6:128101362-128101384 CATCCTTAATAGAAGCAGGAAGG - Intronic
1017757692 6:157543561-157543583 CAGCCTTCACTAAAGCTGGAGGG + Intronic
1018602916 6:165564344-165564366 AAGCCTACACAAATGCAAGAGGG + Intronic
1018779297 6:167047206-167047228 CAGCCTTCATAGAATCACGAGGG + Exonic
1019246293 6:170712511-170712533 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1022209075 7:28190837-28190859 GAGCCATCACAGAGGCAGGAAGG + Intergenic
1023066647 7:36384542-36384564 CAGCTTACACTGTAGTAGGAAGG + Intronic
1024196388 7:47063651-47063673 TAGCCTACACAAAATCAGAATGG + Intergenic
1024407716 7:49001772-49001794 CAGGCACCACAGGAGCAGGATGG - Intergenic
1026742294 7:72986428-72986450 CAGCCTCCCGAGTAGCAGGAGGG + Intergenic
1026802142 7:73406850-73406872 CAGCCTCCCGAGTAGCAGGAGGG + Intergenic
1027028415 7:74871162-74871184 CAGCCTCCCGAGTAGCAGGAGGG + Intergenic
1027101441 7:75378650-75378672 CAGCCTCCCGAGTAGCAGGAGGG - Intergenic
1028210542 7:88069071-88069093 GAGCACACACAGAAGCAAGAGGG - Intronic
1028516657 7:91684844-91684866 CAGCCTCCTCATCAGCAGGATGG + Intergenic
1028607116 7:92667048-92667070 AGACCTACACAGAATCAGGATGG - Intronic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1033398948 7:141003374-141003396 CAGCCTGTACAGAAGTACGATGG - Intergenic
1034325262 7:150224731-150224753 CAGCCTACACTGAAGGAGTGAGG + Intergenic
1034767939 7:153744515-153744537 CAGCCTACACTGAAGGAGTGAGG - Intergenic
1035501779 8:95178-95200 CAGCCAGCACAGCAGCAGGTGGG + Intergenic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1035715923 8:1754877-1754899 CTGCCTGCCCAGAAGCAGGCCGG + Intergenic
1036677893 8:10850415-10850437 CAGCTTGCACAAAAGCTGGAAGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037734396 8:21555108-21555130 CAGCTTACAGAGGAGAAGGAGGG + Intergenic
1037837737 8:22224151-22224173 CAGCCAGGACAGGAGCAGGAAGG + Intronic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1041465687 8:58155591-58155613 CAGATTACAAAGAACCAGGAAGG - Intronic
1042844367 8:73155715-73155737 CAGACTTCCCAGAAGCAGCAGGG + Intergenic
1043740686 8:83807884-83807906 CAGCCTACACACTGGGAGGATGG - Intergenic
1046488446 8:114916389-114916411 CAGCCTACCCAGAAGCTGAGTGG + Intergenic
1046764907 8:118058948-118058970 CATCATACAGAGAAGCAGAAGGG - Intronic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1047121918 8:121914159-121914181 GAACCTACACAAAAGCAAGATGG - Intergenic
1047219933 8:122911098-122911120 CGGTCTACACACACGCAGGATGG + Intronic
1048849843 8:138634500-138634522 CAGCCTACACTGAAGGCAGAGGG + Intronic
1049039836 8:140104264-140104286 CAGCCTGAACGGAACCAGGAGGG + Intronic
1051477848 9:17528149-17528171 CAGCCCACACATAAGGAGTAGGG - Intergenic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055817540 9:80224615-80224637 CAGTATTCACAAAAGCAGGAAGG + Intergenic
1056064823 9:82923279-82923301 CTCCCTGCACAGAACCAGGAGGG - Intergenic
1059153219 9:111967500-111967522 CAGCCGACACAGAAGCAGCCAGG - Intergenic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1059541165 9:115131967-115131989 CAGCCTAGACAGAAGGTGGGTGG - Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060022038 9:120140120-120140142 CAGCCTACCCAGAAAGGGGAAGG - Intergenic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061499537 9:130993977-130993999 TAGCCTAAACAGGAGCAGGGAGG - Intergenic
1203607057 Un_KI270748v1:67894-67916 CAGCCAGCACAGCAGCAGGTGGG - Intergenic
1186543500 X:10425182-10425204 CAGCCCACACTGAAGAAGAAAGG - Intergenic
1188335085 X:28921615-28921637 CAAACTACAAAGAAGCAGGTTGG + Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1189522638 X:41785806-41785828 CAGCCTATACACAAGGGGGATGG - Intronic
1190414784 X:50170215-50170237 CAGCCCACACTCAAGCAGAAGGG - Intergenic
1190742344 X:53297777-53297799 CAGCCTAGATTGCAGCAGGAAGG - Intronic
1191133741 X:57041964-57041986 CATCCAGCACAGGAGCAGGAAGG + Intergenic
1191875182 X:65788348-65788370 CAGCTGACTCAGAAGCAAGACGG + Intergenic
1192726945 X:73763726-73763748 CAGCCAACACAGCAGCTGCAGGG - Intergenic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1192801179 X:74466057-74466079 AAGCCTAGAAAGAAGCAGGCAGG + Intronic
1195175232 X:102308350-102308372 CAGCGTAGAAAGAAGCAGAAAGG - Intronic
1195183633 X:102378743-102378765 CAGCGTAGAAAGAAGCAGAAAGG + Intronic
1195419757 X:104661348-104661370 CACCATAAACAGAAGCAGTAAGG - Intronic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1198156928 X:133970130-133970152 CTGCCTAAACAGCAACAGGAAGG - Intronic
1199145945 X:144367367-144367389 CAGCATACAGAAAAGCAGCATGG - Intergenic
1199504172 X:148542986-148543008 CAACTCACACAGAAGCAGTAAGG - Intronic
1200125504 X:153812277-153812299 AAGCCAACACACAAGCAGAAGGG + Intronic