ID: 1182654637

View in Genome Browser
Species Human (GRCh38)
Location 22:31880266-31880288
Sequence CTGCAGGAATGGTGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182654637_1182654647 30 Left 1182654637 22:31880266-31880288 CCTCCTTTCCACCATTCCTGCAG 0: 1
1: 0
2: 1
3: 33
4: 355
Right 1182654647 22:31880319-31880341 GAAAGGCAATGACCTCTGATAGG 0: 1
1: 0
2: 2
3: 14
4: 162
1182654637_1182654643 -10 Left 1182654637 22:31880266-31880288 CCTCCTTTCCACCATTCCTGCAG 0: 1
1: 0
2: 1
3: 33
4: 355
Right 1182654643 22:31880279-31880301 ATTCCTGCAGCTCTAAGATGGGG 0: 1
1: 0
2: 1
3: 19
4: 245
1182654637_1182654644 -9 Left 1182654637 22:31880266-31880288 CCTCCTTTCCACCATTCCTGCAG 0: 1
1: 0
2: 1
3: 33
4: 355
Right 1182654644 22:31880280-31880302 TTCCTGCAGCTCTAAGATGGGGG 0: 1
1: 0
2: 3
3: 25
4: 254
1182654637_1182654646 13 Left 1182654637 22:31880266-31880288 CCTCCTTTCCACCATTCCTGCAG 0: 1
1: 0
2: 1
3: 33
4: 355
Right 1182654646 22:31880302-31880324 GTAAACAGCTGCTTATTGAAAGG 0: 1
1: 0
2: 2
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182654637 Original CRISPR CTGCAGGAATGGTGGAAAGG AGG (reversed) Intronic
900909249 1:5583188-5583210 CTGCAGGATGGGATGAAAGGCGG - Intergenic
901237610 1:7675926-7675948 CTGCAGCAACGCTGGAATGGTGG - Intronic
901668156 1:10838190-10838212 CTGCAGGAACGGTTGCAGGGAGG + Intergenic
901855475 1:12041806-12041828 CTGCAGGAGGAGTGGAATGGAGG - Intergenic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
904313244 1:29642853-29642875 GTGCAGGAATGGAGGGATGGTGG - Intergenic
904984142 1:34530681-34530703 TTGCTGGAAAGATGGAAAGGTGG + Intergenic
905650036 1:39650163-39650185 CTGAAGGAATGTTGGACAGGAGG + Intergenic
906134234 1:43484582-43484604 GCCCAGGGATGGTGGAAAGGGGG - Intergenic
908475540 1:64484188-64484210 CTGAAGCAGTGATGGAAAGGAGG + Intronic
909378449 1:74968126-74968148 CTCCTGGAATGGTGGGAATGAGG - Intergenic
911065848 1:93787242-93787264 TTGAAGGAATGGAGGAAAAGGGG + Intronic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
912951152 1:114121355-114121377 TTGGAGGAATGCTGGAAAGAAGG - Intronic
913247022 1:116879064-116879086 CTGCTGGAAAGGGGGAAGGGAGG - Intergenic
917500857 1:175583693-175583715 CTACAGGAATGAGGGGAAGGGGG - Intronic
917635823 1:176935018-176935040 CTGCAGGGTTGGGGGAGAGGAGG - Intronic
918607145 1:186441687-186441709 TTGCAGGAAGGGAAGAAAGGAGG - Intergenic
920122472 1:203669087-203669109 CTGGAAGAATGGTGGGATGGTGG - Intronic
921295263 1:213695392-213695414 CTGGAGGAGTGGTGGAGAGGTGG + Intergenic
921948430 1:220905036-220905058 CTGCAGGCATGGCTGACAGGTGG - Intergenic
922157801 1:223053603-223053625 CTGCAGGAATGGGGGTGATGTGG + Intergenic
922195217 1:223353765-223353787 CTGCAGTGATGGTGGCCAGGGGG - Intronic
923291271 1:232548656-232548678 CTGCAGGAGTAGTGAAAAGAGGG + Intronic
924118513 1:240771761-240771783 CAACAGGCATTGTGGAAAGGAGG - Intergenic
924501728 1:244644601-244644623 CTGCAGGCTTGGTGCAAATGTGG - Intergenic
1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG + Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064317692 10:14273752-14273774 CTCCAGGAAGAGTGGAGAGGAGG + Intronic
1064428953 10:15255004-15255026 CTGCATGAATGGGGGAAGGGAGG - Intronic
1064642311 10:17427124-17427146 GTGCATGAAAGGGGGAAAGGGGG + Intronic
1064778848 10:18810768-18810790 ATGGAGGAATGGAGGAAGGGAGG - Intergenic
1064778851 10:18810776-18810798 ATGGAGGAATGGAGGAATGGAGG - Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1067343729 10:45423419-45423441 GTCCAGGAAAGGTGGAAAAGAGG - Intronic
1067495600 10:46757487-46757509 CTGCAGGACTGCGGGAACGGCGG + Intergenic
1067599053 10:47582901-47582923 CTGCAGGACTGCGGGAACGGCGG - Intergenic
1067811673 10:49432427-49432449 CTGAAGGAAAGGAGGAGAGGAGG + Intergenic
1067948716 10:50709486-50709508 CTGCAGGACTGCGGGAACGGCGG - Intergenic
1069619261 10:69826406-69826428 CTGCAGCAGTGGTGGCATGGGGG + Intronic
1069784292 10:70977883-70977905 CTGCAGGGATGATGGATGGGAGG + Intergenic
1069818920 10:71215665-71215687 CTCCAGGAAGGGCTGAAAGGTGG - Intronic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1072108554 10:92296270-92296292 AAACAAGAATGGTGGAAAGGGGG + Intronic
1072786167 10:98284324-98284346 CTGCATTAATGGTGTAAGGGTGG - Intergenic
1073128311 10:101167129-101167151 CTGCAGGGATCCTGGCAAGGGGG - Intergenic
1073192885 10:101664520-101664542 CAACAGGAATGGTGGCAGGGAGG + Intronic
1073480110 10:103781037-103781059 CTGCAGGAGTGATGGGGAGGAGG - Intronic
1073575822 10:104622356-104622378 CTGCAGGAATGGTGTCAGAGAGG + Intergenic
1075283037 10:121157584-121157606 ATGGAGGAAGGGTGGAAAGAGGG + Intergenic
1075715940 10:124555372-124555394 CTGGAGGAAGGGAGGAAGGGAGG + Intronic
1075777041 10:124995880-124995902 CTGCAGGAACGGGGGAAGGCAGG - Intronic
1076074609 10:127523229-127523251 CTGCATGAGTGGTGGAGGGGAGG + Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1077061693 11:620387-620409 CTTCAGGGATGGCGGAAGGGAGG + Intronic
1080646856 11:34193810-34193832 CTGCAGGAGTAGATGAAAGGAGG + Intronic
1080699249 11:34630649-34630671 GTGCAGGAATGTAGGAAGGGTGG - Intronic
1081221025 11:40461951-40461973 AGGGAGGAATGATGGAAAGGAGG + Intronic
1081270704 11:41078901-41078923 ATGCAGGCAAGGTGGAATGGAGG - Intronic
1084493675 11:69491667-69491689 ATGCAGGAATGGGTGAGAGGAGG - Intergenic
1084708845 11:70831497-70831519 CTGCAGGGAGGGAGGCAAGGGGG - Intronic
1084743252 11:71152505-71152527 CAGCAGGAAGGGCGGCAAGGAGG + Intronic
1084983754 11:72849213-72849235 CTACATGAATGTTGGAAGGGAGG - Intronic
1086426185 11:86684762-86684784 TTGGAGGTATGGTGGAAAGGGGG + Intergenic
1087398666 11:97635534-97635556 CAGAAGGAATGGTGGAAGGAAGG + Intergenic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1089581843 11:119486322-119486344 GTCCAGGAAGGGAGGAAAGGAGG - Intergenic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1090939631 11:131375627-131375649 CAGCGTGAATGGTGGAGAGGGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091126153 11:133100166-133100188 GAGCAGGAAGGGTGGAAAGAGGG + Intronic
1092236177 12:6811182-6811204 TTGGAGGAATGGGGCAAAGGTGG - Intronic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1093542401 12:20303004-20303026 CTGCAGGAATGCTAGCAAGGTGG - Intergenic
1093693547 12:22134898-22134920 CTGAAGACATGGTGGAAAAGAGG + Intronic
1093825180 12:23676064-23676086 ATGCAGGGATGGTGAAAATGGGG + Intronic
1094640125 12:32266195-32266217 CTGCAGCAATGGTGGAAGGAGGG + Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1096028494 12:48389295-48389317 CTACAGGAATGGGGAAAATGGGG + Intergenic
1096621606 12:52869059-52869081 GTGCAGAGATGGTGGAAAGGAGG + Intergenic
1096973996 12:55688174-55688196 CTGCAGGGTTGGGGGATAGGTGG - Intronic
1097008805 12:55938114-55938136 CTGAAGGAATAAGGGAAAGGAGG - Intronic
1097142189 12:56911298-56911320 CAGCAGGAATGGGGAAAGGGAGG - Intergenic
1097842292 12:64333256-64333278 CTGCTGGCATGCTGGAAAGGAGG + Intronic
1098003738 12:65972505-65972527 CTGAAGGAAGGGTGGTGAGGAGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101119005 12:101559968-101559990 CTGTAGGGATGGTGGAGTGGAGG - Intergenic
1101844916 12:108355646-108355668 TTACATGAATGGTGGAAACGAGG - Intergenic
1102043778 12:109817169-109817191 CTGCAGGAATGGGGGCCAGGGGG + Intronic
1103924888 12:124418233-124418255 CCGCAGGGATCGTGGAAGGGTGG - Intronic
1103948036 12:124537932-124537954 CTGCAGGAAGGCTGGAAACAGGG + Intronic
1103974870 12:124695938-124695960 TTGGAGGAATGGTGGTAAGAGGG + Intergenic
1104960229 12:132485084-132485106 CAGCAGGCATGTTGGAAAGCAGG - Intergenic
1105424402 13:20282622-20282644 CTGCAGGGATGGTGGGGGGGGGG - Intergenic
1105627698 13:22129128-22129150 CTGCAGGAAGGGCTGGAAGGTGG + Intergenic
1106149345 13:27083440-27083462 CTGCTGGCATGGGGGCAAGGGGG - Intronic
1106461910 13:29978157-29978179 CTGAAGGAATTGCGGAAAGGAGG + Intergenic
1106568272 13:30905762-30905784 CTGAAGGAAAGGCTGAAAGGAGG + Intergenic
1107408833 13:40139839-40139861 ATGAAGAAATGGTGGAAAAGGGG - Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1110998710 13:82148920-82148942 ATGCAGGCATGGTGTAAAGTAGG - Intergenic
1112879134 13:104084667-104084689 TTGGGGGAAGGGTGGAAAGGGGG - Intergenic
1113887644 13:113669359-113669381 CTGCAGGATTGCTGGGCAGGCGG + Intronic
1114404740 14:22445854-22445876 CTGCAGGAATGGGGAAGAGCAGG + Intergenic
1114651879 14:24290344-24290366 CTGAAGAGATGGTGGAATGGGGG + Intergenic
1114666048 14:24377756-24377778 CTCCAGGAAGGAGGGAAAGGGGG - Exonic
1115688556 14:35821982-35822004 AAACAGGAAAGGTGGAAAGGAGG - Intergenic
1116954550 14:50910774-50910796 CTGCAGGAAAAGTGGAAGGAAGG - Intronic
1116972041 14:51076351-51076373 ATGGAGGAATGGAGGAAAGGAGG - Intronic
1116972043 14:51076359-51076381 GAGCAGGAATGGAGGAATGGAGG - Intronic
1117152734 14:52905730-52905752 CTGGAGGAAGGGCAGAAAGGAGG + Intronic
1118526713 14:66652810-66652832 CTGCTGGGATGGGAGAAAGGAGG - Intronic
1121627063 14:95393598-95393620 CTGCAGGCCTGATGGAGAGGGGG - Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122245123 14:100397029-100397051 CTGCTGGAGGGGTGGCAAGGTGG + Intronic
1125465646 15:39949192-39949214 ATGAAGAAATGCTGGAAAGGCGG + Exonic
1126154897 15:45556829-45556851 GTGCAGGAGTGAGGGAAAGGAGG - Intergenic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126683245 15:51224591-51224613 ATGCAGGAAGGGTGGAGGGGAGG - Intronic
1127359439 15:58232019-58232041 AAGCAAGAATGATGGAAAGGAGG + Intronic
1127889828 15:63240017-63240039 ATGCAGGAGTGCAGGAAAGGAGG + Intronic
1128968596 15:72086401-72086423 CAGCAGCAATGTTGGCAAGGGGG + Intronic
1130090386 15:80815980-80816002 CTGGAGGAATATTGGAAAGAGGG - Intronic
1130133203 15:81160725-81160747 ATGCAGGGATGGAGGAAGGGAGG - Intronic
1131063186 15:89416947-89416969 CCGCAGGGATGGGGGAAGGGTGG - Intergenic
1132101826 15:99029106-99029128 CTGCAGAAATTGTGGGGAGGTGG + Intergenic
1133001686 16:2854970-2854992 ATACAGGAATGGCTGAAAGGGGG - Intronic
1133420092 16:5638554-5638576 CTAAAGGAAGGGTGGAAAAGTGG + Intergenic
1133839296 16:9394129-9394151 AAGCAGGAAGGGAGGAAAGGTGG - Intergenic
1135610177 16:23859528-23859550 GTGCTGTAATGGTGGAGAGGGGG + Intronic
1135792157 16:25407142-25407164 ATACTGGAATGGTGGAAAGATGG + Intergenic
1138343859 16:56308093-56308115 CTGCAGGAAAGGAGGAAGAGTGG + Intronic
1139306873 16:65994114-65994136 CTGAAGCAATGGAGAAAAGGAGG + Intergenic
1141110058 16:81265132-81265154 CTGAATGAATGGTGGATAGATGG - Intronic
1141830441 16:86507389-86507411 CAGAAAGAAGGGTGGAAAGGAGG + Intergenic
1142426597 16:90004928-90004950 CAGCAGGAAGGATGGAAAGATGG + Exonic
1142781828 17:2187096-2187118 CTGAAGGAAGGCTGGAAGGGTGG - Intronic
1143844654 17:9764968-9764990 CTGCAGTGATGGTGGAAGGAAGG - Intergenic
1144801687 17:17933185-17933207 CAGCTGGAAGGATGGAAAGGAGG - Intronic
1146894959 17:36534516-36534538 CTGCCGGCCAGGTGGAAAGGTGG + Intronic
1147594074 17:41705536-41705558 CTCCAGCGATGGAGGAAAGGAGG + Intergenic
1148457454 17:47818617-47818639 CTGCAGAAGTGATGGAGAGGGGG + Intronic
1149511277 17:57243743-57243765 CTGCAAGGGTGGTGGAGAGGAGG + Intergenic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150005049 17:61464021-61464043 CTCCAGGAATGGGGGAAGTGAGG - Intronic
1150330204 17:64288163-64288185 ATACAGGAATGCTGGAAAGAAGG + Intergenic
1150596302 17:66608722-66608744 CTCCAGGAAGGTTGGGAAGGAGG + Intronic
1151433943 17:74082633-74082655 ATCCAGCAATGCTGGAAAGGAGG + Intergenic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152473584 17:80503587-80503609 ATGGAGGGATGGTGGATAGGTGG + Intergenic
1152473721 17:80504114-80504136 ATGGAGGGATGGTGGATAGGTGG + Intergenic
1152694046 17:81734931-81734953 CTGCAGGCAGGGTGCAGAGGAGG + Intergenic
1153975319 18:10263779-10263801 CTGGAGGAACGGGAGAAAGGTGG + Intergenic
1155372306 18:25114274-25114296 CTGCAATACTGGTGGAAAAGAGG + Intronic
1156417952 18:36918203-36918225 CTGCAAGACTGATGGAAAAGGGG - Intronic
1157131821 18:45014338-45014360 CTGCAGGAAAGAAGCAAAGGAGG + Intronic
1157970018 18:52256014-52256036 ATGCAGGAATGGGAGAAAGCTGG - Intergenic
1159892769 18:73968253-73968275 CTGCAGGAATGCTAGACTGGCGG - Intergenic
1160292760 18:77609281-77609303 CTGCATGGATGCTGTAAAGGGGG - Intergenic
1160475819 18:79186779-79186801 CTGCAGGAAGGGTGGACTGAAGG - Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161551088 19:4912681-4912703 CTGCAGTAATAAGGGAAAGGTGG - Intronic
1161849890 19:6732812-6732834 CCGCAGGACTGGTGGACAGAGGG + Intronic
1163291889 19:16384373-16384395 CTGCTGGAAAGTTGGAAATGGGG - Intronic
1164776110 19:30854952-30854974 TTCCAGGAATCATGGAAAGGTGG - Intergenic
1166401504 19:42484215-42484237 GTACAAGAATGGGGGAAAGGTGG - Intergenic
1166627751 19:44374772-44374794 TATCAGGAATGGTGGAAGGGAGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925442602 2:3901214-3901236 CTGCAAGAATGGTAAAAATGGGG + Intergenic
925876694 2:8317352-8317374 GGGCAGGAATGCTGGAAAGGAGG + Intergenic
926707840 2:15849282-15849304 GAACAGGAATGGTGGCAAGGGGG + Intergenic
927008221 2:18873855-18873877 CTACAGGAATGCAGGAAAGAAGG + Intergenic
927072835 2:19548270-19548292 CTGCAGGGATGGGGGCAGGGAGG - Intergenic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928654240 2:33433353-33433375 CAGCAGGAATAATGAAAAGGTGG - Intergenic
929856591 2:45643260-45643282 GTGCAGCCACGGTGGAAAGGTGG - Intergenic
930991613 2:57663226-57663248 CATCAGGAATGGGGGAAAAGTGG - Intergenic
931019519 2:58027563-58027585 TTGGTGGATTGGTGGAAAGGGGG + Intronic
931185659 2:59948611-59948633 TTACAGATATGGTGGAAAGGTGG - Intergenic
933772626 2:85753958-85753980 CTCCAGAAATGCTGGCAAGGAGG + Exonic
934555218 2:95283480-95283502 CTTCAGGAGAAGTGGAAAGGTGG - Intronic
935542770 2:104369187-104369209 ATGGTGGAATGGTGGAATGGTGG + Intergenic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
937227102 2:120376231-120376253 CAGCACGAATGGTGGAAACTGGG + Intergenic
937901659 2:127024713-127024735 CTGCAAGACTCGTGGGAAGGAGG + Intergenic
938545761 2:132329807-132329829 TATCAGGAATGGTGGAAGGGAGG + Intergenic
938815031 2:134893566-134893588 TTGCAGAAATGGAGGACAGGGGG - Intronic
939280275 2:140055139-140055161 CTGCAGGAGTGGGGGTAGGGTGG - Intergenic
939444841 2:142295676-142295698 AGGCAGGAAGGGTGGAAGGGAGG - Intergenic
941885567 2:170523895-170523917 CTGCAGGAGAGCTGCAAAGGAGG + Intronic
941944432 2:171079000-171079022 ATGCAGGAATGGTGAAAGGTAGG - Intronic
942558763 2:177198692-177198714 CTGGAGGCATGGGGCAAAGGGGG - Intergenic
942610516 2:177737639-177737661 CTACAGGAATGCTGGGAGGGTGG + Intronic
943184775 2:184593975-184593997 CTGTAGAAATTGTGGAAATGTGG - Intergenic
945276951 2:207997654-207997676 CAGCAGGAATGGGAGAAGGGAGG + Intronic
946159355 2:217826673-217826695 CTCCAGGATTGGAGGGAAGGAGG - Intronic
946251029 2:218412472-218412494 CTGCATGAGTGTTGCAAAGGTGG - Intergenic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948407754 2:237735354-237735376 CAGCAGGCACGGGGGAAAGGAGG - Intronic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1170030156 20:11935988-11936010 AGGCAGGAAGGGTAGAAAGGAGG - Intergenic
1171874622 20:30562561-30562583 TATCAGGAATGGTGGAAGGGAGG + Intergenic
1172187206 20:33038435-33038457 TGACAGGAATGGTGGATAGGAGG - Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173825224 20:46043812-46043834 GTGCAGGAAGGGTGGGGAGGGGG + Intronic
1174667170 20:52270489-52270511 CTGCTGGAATGAAGGAAATGTGG + Intergenic
1174959525 20:55139501-55139523 AGGCAGGAAAGGAGGAAAGGAGG - Intergenic
1176155239 20:63616684-63616706 CAGCAGGAATGAGGGAAAGGAGG + Intronic
1178637495 21:34317400-34317422 AAGAAGGAATGGGGGAAAGGAGG - Intergenic
1180160305 21:45996192-45996214 CAGGAGGAAGGATGGAAAGGAGG - Intronic
1180710379 22:17835534-17835556 CTGGAGGAAAGGTGCAGAGGAGG + Intronic
1181811873 22:25408125-25408147 CTGCAGGAATCAAGGGAAGGGGG + Intergenic
1181977049 22:26737592-26737614 CTGCAGGAAAAGTGGGATGGAGG - Intergenic
1181978929 22:26752459-26752481 GAGCAGGAATGGTGGACATGTGG + Intergenic
1182474522 22:30569378-30569400 CAGCAGGTATGGAGGAGAGGAGG + Intronic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1182697101 22:32205217-32205239 CAGCCAGAATGGTGAAAAGGTGG + Intergenic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1183349152 22:37325036-37325058 CGGCAGGGAGGGTGGGAAGGGGG - Intergenic
1183727268 22:39596699-39596721 CTGCAGGAAGGGTGGTTTGGAGG + Intronic
1184370029 22:44076290-44076312 CTCTAGGAATGGTGAAAGGGCGG + Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184639267 22:45860463-45860485 CAGCAGGGAGGATGGAAAGGAGG - Intergenic
1185101357 22:48842613-48842635 TTGCAGGAAGGATAGAAAGGTGG + Intronic
1185131382 22:49041045-49041067 TGGGAGGAATGGTGGACAGGTGG + Intergenic
1185154551 22:49185353-49185375 GTGGACGAATGGTGGAAAGGTGG - Intergenic
951010394 3:17670480-17670502 CTTCAGGAACAGTGGAAAGGGGG + Intronic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953726021 3:45399785-45399807 TTGGGGGAAGGGTGGAAAGGGGG - Intronic
955335267 3:58080325-58080347 CTCCAGTAATGGTGCTAAGGAGG - Intronic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
957981057 3:87511137-87511159 CTCCAAGAATGTTGGAAATGTGG + Intergenic
958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG + Exonic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960583938 3:119303571-119303593 CTCCAGTAGTGGTGGGAAGGGGG - Intronic
961503103 3:127351186-127351208 CTCCAGGGAGGGTGGAGAGGAGG - Intergenic
962111118 3:132449433-132449455 CTGCAGGAATGGGAGAAGGCAGG - Intronic
964653509 3:159040192-159040214 CTGGAGGAATGCTGGAAGAGAGG - Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
967237524 3:187400213-187400235 CTGCAGGAAAGGCTGAAAAGAGG + Intergenic
968280963 3:197476379-197476401 AGGCAGGAAGGGTGGAAAGAAGG + Intergenic
968560077 4:1275020-1275042 CTGCAGTAACGGAGGAAATGGGG - Intergenic
968627518 4:1633872-1633894 CTGCAGGAAAAGAGAAAAGGGGG + Intronic
968659832 4:1794349-1794371 CAGCGGGAATCGTGGAAATGGGG - Intronic
968969575 4:3786608-3786630 CTGCAGGGATGGTGCAAAAAAGG - Intergenic
969271335 4:6105403-6105425 CTGCACGCATGGGGGAAATGCGG - Intronic
969426608 4:7128111-7128133 CTGCAGCAAGGGAGGAAAGAGGG + Intergenic
971567190 4:28160255-28160277 CTGAAGGAATGGCGTACAGGTGG + Intergenic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
973605074 4:52578646-52578668 CTGGAGGAATGAAGGAAAGGAGG + Intergenic
973964416 4:56146990-56147012 ATGCGGGAGTGGTGGCAAGGTGG + Intergenic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
976561957 4:86511842-86511864 GAGCAGGAATGAAGGAAAGGAGG + Intronic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
978379420 4:108111444-108111466 CTGCCTGAAGGGAGGAAAGGAGG + Intronic
978381761 4:108135894-108135916 GGGCAGGATTGGGGGAAAGGGGG - Intronic
979341374 4:119528243-119528265 TTGCAAGAATGGTGAAAAGAGGG - Intronic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
980156074 4:129108420-129108442 CTGAATGAATGGTAGAAAGCAGG + Intronic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
980643966 4:135617656-135617678 CTCCAGGAATGATCAAAAGGTGG - Intergenic
980697908 4:136383398-136383420 AAGCAGGAATCCTGGAAAGGCGG - Intergenic
981328940 4:143485364-143485386 ATGCAGAAAAGTTGGAAAGGAGG + Intergenic
982277704 4:153653513-153653535 CACTAGGAATGGTGGAAATGGGG - Intergenic
983293918 4:165841158-165841180 CTGGAGGAAGGGAAGAAAGGGGG + Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
985205707 4:187533610-187533632 CTAGAGGAATTGAGGAAAGGTGG + Intergenic
985275129 4:188230968-188230990 GTGCAGCACAGGTGGAAAGGTGG + Intergenic
985485611 5:146603-146625 CTGCAGGGTTGGGGGAGAGGAGG - Intronic
985878435 5:2618933-2618955 CTGTAGGAATGGTGCAGAGGTGG - Intergenic
986388336 5:7261311-7261333 CTGCAGGAGTGGGGGAACCGGGG + Intergenic
987614712 5:20258776-20258798 CTACAGGAATGGTGAAGAGGTGG + Intronic
987874758 5:23667110-23667132 GTGCAGGCAGGGTGGAATGGAGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988992597 5:36686042-36686064 CTGCAGGCAGGGTGGGGAGGAGG - Intronic
989495794 5:42110293-42110315 ATGCAAGAATGGTGAAAATGTGG + Intergenic
991469601 5:66954025-66954047 CTGCATTAATGGTGGAAATATGG - Intronic
992004190 5:72461407-72461429 CTGCAGGCAGTGGGGAAAGGAGG + Exonic
993518125 5:88863182-88863204 CTGCAGGCATGTTGAAAATGAGG - Intronic
996138828 5:119878859-119878881 CTGCAGGATTGGTGGATCAGAGG + Intergenic
997046551 5:130325867-130325889 CAGCAGCAATGGAGGAAATGAGG + Intergenic
998405780 5:141874089-141874111 GTCCAGGAATGGTGGGGAGGCGG - Intronic
999099032 5:149006953-149006975 CTGCAGCCATGGTGGACAGAGGG + Exonic
1000951429 5:167488348-167488370 TTGGTGGAATGGTGGAAGGGTGG - Intronic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1002503722 5:179664630-179664652 CTCCAGGAACAGTGGAAAGAAGG - Intergenic
1002570007 5:180134856-180134878 ATGTAGGAAGGGTGGACAGGTGG - Intronic
1002643011 5:180639520-180639542 ATGAATGGATGGTGGAAAGGTGG + Intronic
1003312042 6:4977811-4977833 CTGCACAAAGGGTGGAAAGAGGG - Intergenic
1003846155 6:10175674-10175696 CTGCAACAATGCTGGAAAGATGG - Intronic
1003942127 6:11040017-11040039 AGGCAAAAATGGTGGAAAGGGGG + Intronic
1004084184 6:12428464-12428486 TTTCAGGAATGGTGGCAGGGTGG + Intergenic
1005266647 6:24119013-24119035 CTTCAGTAATGGTGGAAGTGAGG + Intergenic
1006309461 6:33247769-33247791 TTACAGGAATGGAAGAAAGGAGG + Intergenic
1007530904 6:42541369-42541391 CTGCAGGCAGGGTGACAAGGGGG - Intergenic
1007640952 6:43339260-43339282 CTATAGTAGTGGTGGAAAGGGGG - Exonic
1011557694 6:88587226-88587248 CAGCAGGCATGGTGTAAAGCGGG - Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1013310962 6:108893453-108893475 CTGCAGGGATCGGGGAAGGGAGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013819574 6:114138433-114138455 ATGATGGAATGGTGGAAATGTGG + Intronic
1015724812 6:136289392-136289414 CTGAAGAAATGGGGGAAGGGTGG + Intronic
1015909573 6:138155603-138155625 CTGCAGGATTTGTGGCAATGTGG - Intergenic
1017953346 6:159157238-159157260 CTGCAGGATTGGTTGGCAGGAGG - Intergenic
1018276343 6:162135748-162135770 CTGAAGGAATGGGGGAGGGGAGG + Intronic
1018648053 6:165966186-165966208 CTGCAGAAAGAGTGGAAAAGTGG + Intronic
1018739982 6:166721204-166721226 ACACAGGAAAGGTGGAAAGGCGG + Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020855810 7:13421283-13421305 CTGCAGTGATGGTGATAAGGTGG + Intergenic
1023189122 7:37560367-37560389 CTGCTACAATGGGGGAAAGGTGG - Intergenic
1023548638 7:41345133-41345155 CTGCAGGGAGGTGGGAAAGGGGG + Intergenic
1023754962 7:43407798-43407820 CTCCATGAATGGAGGGAAGGAGG - Intronic
1024803120 7:53103873-53103895 AGGCAGGAATGGTGGAAATGAGG + Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028858956 7:95625602-95625624 CTGCAAGAAGGGTGGACATGTGG + Intergenic
1029131657 7:98335933-98335955 CTGAAGGAATGATAGACAGGGGG + Intronic
1030685378 7:112480925-112480947 TGGCAGGAGTGCTGGAAAGGTGG + Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032992190 7:137405969-137405991 CTCCAGGAAAGGTGAAAAGATGG + Intronic
1034676269 7:152894705-152894727 CTGAAGGAATGGAGCAAAAGCGG + Intergenic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034972264 7:155426721-155426743 CTGTAGCCAGGGTGGAAAGGGGG - Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035853851 8:2951267-2951289 CTGAAGGAACTGTGGGAAGGGGG + Exonic
1036799240 8:11777530-11777552 CTGCAGGGAGGGAGGAAAGGGGG - Intronic
1036957320 8:13202501-13202523 CTGCAGAGATGGTAGAAAGACGG - Intronic
1037520282 8:19674411-19674433 CTGCAGATATGGTGGCAGGGGGG + Intronic
1037583083 8:20257464-20257486 TTGGAGGAATGGTGGAAGGAAGG + Intronic
1037839244 8:22232267-22232289 CTGGAAGAATGGGGGAAAGGCGG - Exonic
1037896147 8:22657687-22657709 CTGCAGGAAGTGGTGAAAGGTGG + Intronic
1040580888 8:48697635-48697657 CTGCAGGAATAGTGGGGATGGGG + Intergenic
1041143115 8:54843742-54843764 CTGCAGGACTGGAGCAAGGGTGG - Intergenic
1042971438 8:74413579-74413601 CTACAGGAATGCTGGAGAGATGG - Intronic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1047926914 8:129691190-129691212 CTGCAGGAAGGCTGGAACAGTGG + Intergenic
1048499278 8:134960960-134960982 GTGCAGGAGTGGTGAATAGGAGG + Intergenic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1050544919 9:6701593-6701615 CTGGAGGAATGGAAGAAAGCAGG + Intergenic
1050773003 9:9227151-9227173 CTTCGGGGATGGTAGAAAGGGGG - Intronic
1051682115 9:19617916-19617938 CTGCAGGAATGCAGGAATGCAGG + Intronic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1053239032 9:36481377-36481399 CTGCAGTGATGTTGGACAGGTGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1055098238 9:72436640-72436662 CTTGAGGAATGGTGAAAAGACGG - Intergenic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056225070 9:84486778-84486800 CTGCAGGAATGGGAGACATGGGG - Intergenic
1056547025 9:87621429-87621451 CTACAGGAATGGAGGAAATCTGG - Intronic
1056688450 9:88785712-88785734 CTACAGAAATGCTGGAAAGGTGG + Intergenic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1059329995 9:113528877-113528899 CTGCAGAAATCATGGAAGGGAGG + Intronic
1059397634 9:114048252-114048274 CAGCAGAAATTGTGGAGAGGTGG - Intronic
1060686685 9:125620864-125620886 CGACATGAATGGTGGACAGGAGG + Intronic
1060840149 9:126786547-126786569 CTGCAGGAATGTCAGAGAGGAGG - Intergenic
1060966932 9:127716748-127716770 CTGCAGGGAGGGAGGAGAGGCGG - Exonic
1061634872 9:131901122-131901144 AAGAAGGAAGGGTGGAAAGGAGG + Intronic
1062022950 9:134327638-134327660 CTGCAGGGAGGGTGGGCAGGAGG - Intronic
1062049633 9:134440650-134440672 CGGCAGGTAGGGTGGACAGGAGG - Intergenic
1062080788 9:134622401-134622423 AGGAAGGAATGATGGAAAGGAGG - Intergenic
1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG + Intronic
1062475809 9:136726614-136726636 CTGAAGGGATAGTGGGAAGGTGG - Intergenic
1062624013 9:137434903-137434925 TTGCAGGACTAGTGGGAAGGCGG - Exonic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1186756087 X:12672943-12672965 CCTCAGGAATGGTGGAAACCAGG + Intronic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1188618050 X:32183001-32183023 CTACAGGAATCCTGGAAAAGAGG + Intronic
1189377833 X:40479640-40479662 CTGCAGAGAGGGAGGAAAGGAGG - Intergenic
1190822285 X:53985108-53985130 CTGCAGGCCTGGTGGACTGGGGG - Exonic
1191898361 X:66016897-66016919 CTCCAGAAAGGCTGGAAAGGAGG - Intergenic
1192166551 X:68830503-68830525 CTGCCGGAGCGGTAGAAAGGCGG + Intronic
1192265179 X:69532774-69532796 CTGCAGGACATGTGCAAAGGAGG + Intergenic
1193136856 X:77981402-77981424 GTGAAGGAATGGTGTAAAGAGGG + Intronic
1193162870 X:78247385-78247407 TTGTAGAAATGGTAGAAAGGAGG + Intergenic
1193636846 X:83961449-83961471 CAGCAGGAAGGGTGGGAGGGGGG + Intergenic
1193738363 X:85186700-85186722 CTGCAGGAATCCTGGATGGGTGG + Intergenic
1193945423 X:87728018-87728040 CTGCTGACAGGGTGGAAAGGAGG + Intergenic
1194213246 X:91095136-91095158 TTGCAGGGGAGGTGGAAAGGTGG + Intergenic
1194558339 X:95389602-95389624 CTACGGGAGTGGGGGAAAGGTGG + Intergenic
1195067478 X:101250619-101250641 TTGCAGGAAGGGTGGGAAGAAGG + Intronic
1195136064 X:101908540-101908562 CTGCAGGGATGGGGGAGGGGTGG - Intronic
1197267550 X:124391558-124391580 CTGCGGGAATGGTGGTAGTGGGG - Intronic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1198041529 X:132857829-132857851 TTGAAGGAAGGGAGGAAAGGTGG + Intronic
1199399680 X:147383244-147383266 CTGAAGGAATGGTGGCAGGGTGG + Intergenic
1199875278 X:151923374-151923396 CTGCAGGATTGATGGTAGGGAGG - Intronic