ID: 1182656623

View in Genome Browser
Species Human (GRCh38)
Location 22:31895423-31895445
Sequence GTGAGCACTGCGATGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182656623_1182656630 7 Left 1182656623 22:31895423-31895445 CCATCCCCCATCGCAGTGCTCAC 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1182656630 22:31895453-31895475 CCAAGTTGTCAGTATCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182656623 Original CRISPR GTGAGCACTGCGATGGGGGA TGG (reversed) Intronic
901794711 1:11673569-11673591 GTGACCACCGGGACGGGGGAGGG - Intronic
902395917 1:16132494-16132516 GTGGGCACAGATATGGGGGAAGG + Intronic
903179151 1:21596841-21596863 GTGAGCACTGGGTTGGGAGCCGG - Intronic
904418894 1:30378948-30378970 GTGAGCACTGTGCTGGGGCTGGG - Intergenic
904466539 1:30711482-30711504 GGGAGAACTGCGATGAGTGAAGG + Exonic
904604395 1:31690998-31691020 GTGAGCACTGGGATGGGGACAGG + Intronic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905227652 1:36489786-36489808 GTGAGCACAGGGTTGGGGGTAGG + Intergenic
905662543 1:39738680-39738702 GTGCGCACCGTGTTGGGGGAGGG - Intronic
905734317 1:40315510-40315532 GTGAGCGCTGTGGTGGGGGTGGG - Intronic
907708221 1:56851367-56851389 GCCTGCACTGGGATGGGGGAGGG - Intergenic
908897274 1:68914400-68914422 ATGTGCACTGTGATGGAGGAGGG - Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
915479028 1:156172717-156172739 ATGAGGACTGCCATGAGGGAGGG + Intronic
916039434 1:160949643-160949665 GTGAGCACAGGGTTGGGGGTAGG + Intronic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
919326159 1:196109556-196109578 GTGAGCACAGGGTTGGGGGTAGG + Intergenic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920127888 1:203708205-203708227 GTGAGAAATGGGATGTGGGATGG - Intronic
920378727 1:205523396-205523418 AGGAGCACAGCGCTGGGGGAGGG + Intronic
921029250 1:211323183-211323205 GGGAGTACTGGGATGGGGCAGGG - Intergenic
922614004 1:226950283-226950305 GTGAGCACTGGGTTGGGAGCTGG - Intronic
923516260 1:234700280-234700302 ATCAGCACTGCTATGGGGGAGGG + Intergenic
924384313 1:243487953-243487975 CTGAGCAGGGCGATGGGGCAGGG + Intronic
1063499080 10:6536954-6536976 GCGAGAACTGGGATGGGGAAGGG - Intronic
1063988867 10:11537743-11537765 GTGAGCACTGCCGGGGTGGAAGG + Intronic
1065750156 10:28878663-28878685 GTGAGCACTGTGTTGGGGGAGGG + Intronic
1065988918 10:30987691-30987713 GTGTGCACTTGGATGGGGGGTGG - Intronic
1066243644 10:33561504-33561526 GTGGGCACTCAGATGGGGGAAGG + Intergenic
1066586910 10:36945678-36945700 ATGAGCACTGGGATAGGGGAGGG - Intergenic
1067836312 10:49643876-49643898 GTGAGTGCTGATATGGGGGAGGG + Intronic
1069239542 10:66123008-66123030 GTGAGGACTGAGATTTGGGAGGG - Intronic
1070515549 10:77202540-77202562 GTGAGCACTGAGTTCTGGGAAGG - Intronic
1073147789 10:101291996-101292018 GTGAGGACGGGGAGGGGGGAAGG - Intergenic
1074399375 10:113129211-113129233 GAGAGGGCTGCGATGGGAGAGGG - Intronic
1075217251 10:120546636-120546658 GAGGGCACTGCGTTGGGGGAAGG - Intronic
1075841805 10:125511247-125511269 CTGAGCACCGCGACGGGGGCGGG - Intergenic
1076271180 10:129153380-129153402 GTGAGCTCTGCAAAGGAGGAGGG + Intergenic
1076733828 10:132450284-132450306 GTGAGGACTGGGGTGGGGGCTGG - Intergenic
1079503887 11:21132765-21132787 GTGAGCAGTGGGGTGGGGGAGGG + Intronic
1079899602 11:26165491-26165513 GTGAGCAGTGCCATGAGAGAAGG + Intergenic
1080963943 11:37193228-37193250 GTGAGTACTGAGATGGTAGATGG + Intergenic
1080972823 11:37300028-37300050 GGGAGCAGTGCGATGGTGGGAGG - Intergenic
1083672533 11:64307117-64307139 GAAAGCACTGGTATGGGGGATGG - Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1085508002 11:77071129-77071151 GTGGGCACTGGGGTGGGGGCGGG - Intronic
1088437373 11:109830150-109830172 GTGGGGACTCCAATGGGGGAAGG + Intergenic
1088746307 11:112807777-112807799 GGAAGCACAGGGATGGGGGAGGG - Intergenic
1089748526 11:120633926-120633948 GTGAGCACGGGGGTGGGAGAAGG + Intronic
1090410829 11:126508523-126508545 ATGAGCCCTGGGATGGTGGAAGG + Intronic
1090587238 11:128226476-128226498 GTGAGCTCTGAGAAGTGGGATGG - Intergenic
1091774038 12:3172646-3172668 GTGAGGACTGAGATGGGCGATGG + Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1097267601 12:57755176-57755198 GAGAGAACGGCGATGGGGGGCGG + Exonic
1102581217 12:113889291-113889313 ATCAGCACTGCTATGGGGAAAGG + Intronic
1106004206 13:25753331-25753353 GTCAGCACTGAGCTGGGGGCTGG - Intronic
1108408314 13:50125454-50125476 GGGAGCGCTGCGCCGGGGGAGGG - Intronic
1114090542 14:19284690-19284712 CTGAGGGCTGCAATGGGGGAAGG - Intergenic
1116891916 14:50276976-50276998 GTCACAACTGGGATGGGGGAGGG - Intronic
1119351938 14:73973053-73973075 GTGAGAACGACGCTGGGGGAAGG + Intronic
1119823179 14:77636097-77636119 GTGAGCACAGGGTTGGGGGTTGG + Intergenic
1122232287 14:100312610-100312632 GTGAGCACAGGGTTGGGGGTGGG + Intergenic
1124189789 15:27564810-27564832 GAGAGCACTGAGAGGGGGGTGGG - Intergenic
1124376422 15:29131972-29131994 GTGAGCACTCGCATGGGTGACGG - Intronic
1124580927 15:30954183-30954205 GTAAGCACTTCCCTGGGGGAGGG - Intronic
1127762482 15:62152389-62152411 GTCAACACTGCGATGGGGTCAGG + Intergenic
1129651716 15:77495888-77495910 GTGAGGGCTGCAGTGGGGGAAGG - Intergenic
1130223687 15:82043119-82043141 GTGCGCACCGTGCTGGGGGAAGG - Exonic
1131261791 15:90891484-90891506 GTGAGCCCTGGGAGGGGGAAAGG - Intronic
1131303922 15:91224387-91224409 GGGAGCACTGGGGTGGGGTAGGG + Intronic
1131431580 15:92393138-92393160 GTCAGCACCGCGAGGGCGGAGGG + Intergenic
1131541637 15:93279799-93279821 ATGTGCACTGTGGTGGGGGAGGG - Intergenic
1132327352 15:100982736-100982758 GTCAGCCTTGCGAAGGGGGAAGG - Intronic
1132698820 16:1213619-1213641 GTGAGCCCTGCCATGAGGCAGGG + Intronic
1133040088 16:3056103-3056125 GTGAACAGGGAGATGGGGGAGGG + Intronic
1133064271 16:3195033-3195055 GTGAGCACTCTGGTGGCGGAAGG + Intergenic
1134893130 16:17859128-17859150 GTTAGCACAGTGATGGCGGAAGG + Intergenic
1135207078 16:20492765-20492787 GTGGGCACTGGGATGGGGAGAGG - Intergenic
1135211807 16:20530867-20530889 GTGGGCACTGGGATGGGGAGAGG + Intergenic
1136073862 16:27804995-27805017 GTGAGGACTGGGATTGGGGGTGG + Intronic
1136073923 16:27805154-27805176 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073936 16:27805187-27805209 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073951 16:27805220-27805242 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136073965 16:27805252-27805274 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136073980 16:27805285-27805307 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136073994 16:27805317-27805339 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074008 16:27805349-27805371 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074022 16:27805381-27805403 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074036 16:27805413-27805435 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074051 16:27805446-27805468 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074066 16:27805479-27805501 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074080 16:27805511-27805533 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074094 16:27805543-27805565 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074108 16:27805575-27805597 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074123 16:27805608-27805630 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074137 16:27805640-27805662 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074151 16:27805672-27805694 GTGGGCACTGGGATTGGGGGTGG + Intronic
1136074166 16:27805705-27805727 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074180 16:27805737-27805759 GTGGGCACTGGGATTGGGGTGGG + Intronic
1136074194 16:27805769-27805791 GTGGGCACTGGGATTGGGGGTGG + Intronic
1137510020 16:49090973-49090995 GTGAGCATTCAGATGGAGGAAGG - Intergenic
1137744056 16:50807902-50807924 GTGAGCCCTGCTCTGGGAGAAGG - Intergenic
1138372437 16:56538015-56538037 GTGAGGACTGGGATGGGAGGGGG - Intergenic
1144668592 17:17118617-17118639 GTGACGACTGGGAAGGGGGAAGG + Intronic
1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG + Intergenic
1147862153 17:43530039-43530061 GGGAGCGCTGCCATGGGGGAGGG - Intronic
1147864901 17:43545705-43545727 GGGAGGGCTGCGATGGGGGCGGG + Intronic
1148860535 17:50602210-50602232 GTGAGCACAGAGAGGAGGGAAGG - Intronic
1148870956 17:50658604-50658626 GTGCCCACTGCGGTGGGGGGTGG - Intronic
1151576239 17:74953891-74953913 ATGGGCACAGGGATGGGGGAGGG - Intronic
1151577673 17:74960937-74960959 GTGAGCACGGGGTGGGGGGAGGG - Intronic
1152617892 17:81346179-81346201 GGGAGCACGGCGCTGGGGGAGGG - Intergenic
1155775742 18:29758265-29758287 GGAAGCACAGCGATGGAGGATGG - Intergenic
1156391646 18:36656135-36656157 GCAAGCACTGCAATGAGGGAGGG - Intronic
1157417766 18:47520372-47520394 GTGGGCACTGCGGGGGGGGGGGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1162621693 19:11848946-11848968 GGGAGTGGTGCGATGGGGGAGGG + Intronic
1164208577 19:23077866-23077888 GTGAGCACAGGGTTGGGGGTAGG - Intronic
1164598633 19:29546673-29546695 GTGAGCACCGGGGTGGGGGTGGG - Intronic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1165259916 19:34604310-34604332 GTGACCACAGGGATGTGGGAAGG - Intronic
1165506488 19:36234184-36234206 GTGAGCACAGGGTTGGGGGTAGG + Intronic
1165633432 19:37320914-37320936 GTGAGCACAGGGTTGGGGGTAGG - Intronic
1165733000 19:38158422-38158444 GTGAGAACTGAGATCAGGGAGGG + Intronic
1166140373 19:40802193-40802215 GTGAGCCCTGGGCTGAGGGAAGG + Intronic
1166719620 19:44989586-44989608 GGGAGCTCTGGGATGGGGTAGGG + Intronic
1167024325 19:46904122-46904144 GACAGCACTGGGATGGGGGTGGG + Intergenic
925923644 2:8654939-8654961 GGGAGCACTGGTATGGGCGATGG - Intergenic
929151278 2:38751164-38751186 GTGAGCACTGCGAGGCCGTAGGG - Intronic
929917866 2:46151242-46151264 GAGAGCACAGCCATGGGTGAGGG - Intronic
932078947 2:68693896-68693918 GGGAGCAGTGAGATGGTGGAGGG - Intronic
932082969 2:68732166-68732188 GAGAGCTCTGTGGTGGGGGAAGG + Intronic
932749644 2:74363257-74363279 GGGAGGACTGGGATGGGAGATGG - Intronic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936692857 2:114913224-114913246 GAGTGCACGCCGATGGGGGAAGG - Intronic
937353526 2:121184086-121184108 ATGAGGACTGGGATGGGGGCAGG - Intergenic
939540692 2:143490386-143490408 TTGAGCACCACGATGGGGGCAGG + Intronic
941367216 2:164622609-164622631 GAATGCACTGAGATGGGGGAGGG - Intergenic
942385626 2:175439634-175439656 GTGGCCACTGCCATGGGGCAGGG + Intergenic
942402745 2:175620942-175620964 GTGAGCACCGCTATGTTGGAAGG + Intergenic
943761253 2:191611892-191611914 GTGTGCACAGGGATGGCGGATGG + Intergenic
943880881 2:193142542-193142564 GTGAGCACAGGGTTGGGGGTAGG - Intergenic
946797350 2:223369916-223369938 GTGAACACTGCTCTGGGTGATGG - Intergenic
947870795 2:233436823-233436845 GTGAGCACAGCCATGTGGAAGGG + Intronic
947872479 2:233447126-233447148 GTGGGCACCGCGGCGGGGGAGGG - Intronic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
948510618 2:238461806-238461828 GTGAGTACTGCCCTGGGGTATGG + Intergenic
948929951 2:241125809-241125831 GTGACCACTGAGGTGGGGGCTGG + Intronic
1168835272 20:873436-873458 GTGAGCAGAGCGATGAGGGGAGG - Intronic
1169247480 20:4034834-4034856 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
1169793460 20:9436705-9436727 GTGTGCACTGGAATGGGAGAAGG - Intronic
1172642141 20:36446938-36446960 GTGAGTACTGTGATGAGGGAAGG + Intronic
1172654292 20:36527605-36527627 GTGAGCACTTGGCGGGGGGAGGG - Exonic
1173182039 20:40813077-40813099 GAGGGCACTGGGATGGGAGAGGG + Intergenic
1173666349 20:44766067-44766089 GAGGGCACTGTGGTGGGGGAGGG + Intronic
1174230329 20:49040980-49041002 GTGAGCACTCCCATGCTGGAAGG - Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175817916 20:61893227-61893249 GTGACCACAGGGATGGTGGATGG + Intronic
1179305859 21:40153532-40153554 GTGATCACAGGGGTGGGGGACGG + Intronic
1179720387 21:43313227-43313249 GTGGGCACTGGGGTGGGGGGTGG - Intergenic
1179798304 21:43798473-43798495 GGGAGGACTGCGTTGGGGGCTGG - Intronic
1179809230 21:43859605-43859627 CTGACCCCTGGGATGGGGGATGG + Intergenic
1180113865 21:45682991-45683013 GTGAGGCCTGGGATAGGGGAAGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180321309 22:11324030-11324052 GTGAGCACAGGGTTGGGGGTAGG - Intergenic
1180490157 22:15837625-15837647 CTGAGGGCTGCAATGGGGGAAGG + Intergenic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1183241465 22:36660787-36660809 GTGAGGACTGGGATGAGGGAAGG - Intronic
1183498659 22:38164987-38165009 GTGAGGGCTGCGATGGGGTGGGG - Intronic
1184468832 22:44684152-44684174 GTGGGCACTGGGGTGGGGGCTGG - Intronic
1184690481 22:46115131-46115153 GTGAGCACAGGCATGAGGGAGGG - Intergenic
1184806555 22:46798384-46798406 GTGAGCCCTGCAAGGGGGCAGGG + Intronic
1185233991 22:49700421-49700443 GTGAGCACTGTGGTGCGAGAAGG - Intergenic
950107642 3:10398443-10398465 GTGAGCACTGAGATGAGAAAGGG - Intronic
950387878 3:12674241-12674263 GTGAGCACAGGGTTGGGGGTAGG - Intergenic
956529064 3:70197338-70197360 GTGAGTACTGACATGGGGGTGGG - Intergenic
957782211 3:84834324-84834346 GTGACCACTGCAATGGGGTGTGG + Intergenic
960520070 3:118644422-118644444 ATGAGAACAGCAATGGGGGATGG + Intergenic
961135322 3:124504740-124504762 GTGAGCACTGGGATGTGGCAAGG + Intronic
961557720 3:127708035-127708057 GTGAGCAGGACTATGGGGGATGG - Intronic
962458103 3:135583882-135583904 CTGAGCAGTGCCATGGGGGCTGG - Intergenic
962986116 3:140537599-140537621 GTGAGCTCAGCCATGGGAGAGGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
965608896 3:170524392-170524414 ATGAGCACTGTGATGGGGGTAGG + Intronic
966882645 3:184358952-184358974 GTGAGAACTGGGGTGGGGGCAGG - Intronic
967176601 3:186866338-186866360 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
967292612 3:187936054-187936076 GTGGGCAGTGGTATGGGGGAAGG - Intergenic
967777760 3:193401937-193401959 GTGTTGACTGTGATGGGGGAAGG - Intergenic
968569815 4:1333711-1333733 GTGAGCACGGGCATGGGGGTGGG - Intronic
968569866 4:1333852-1333874 GTGAGCACGGGCATGGGGGTGGG - Intronic
969709933 4:8836939-8836961 GTGAGCACTGCAGGGTGGGAAGG + Intergenic
971026988 4:22598588-22598610 GTGAGCACAGGGTTGGGGGTAGG + Intergenic
981717760 4:147768472-147768494 GAGACCACTGTGATGGGGCAAGG - Intronic
982276443 4:153640824-153640846 AGGAGCACTGCTATAGGGGAAGG + Intergenic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
986017312 5:3768663-3768685 AAGAGTACTGCGATGGGAGAAGG + Intergenic
987355360 5:17059012-17059034 GTGATAACTGAGCTGGGGGAAGG + Intergenic
987660724 5:20872217-20872239 ATGAGCACTGAAATGGGGCAAGG - Intergenic
988762921 5:34333468-34333490 TTGAGCACTGAAATGGGGCAAGG + Intergenic
990070760 5:51780435-51780457 GTTATCACTCCCATGGGGGATGG - Intergenic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990475346 5:56157123-56157145 GCGAGCACAGGGATGGGGGTAGG - Intronic
991107706 5:62862398-62862420 GTGGGCACTGGGAGTGGGGATGG + Intergenic
993922273 5:93820228-93820250 TTGAGCACTGCAAACGGGGAAGG + Intronic
994296320 5:98092791-98092813 GGGAGCACAGAGATGGGAGAGGG + Intergenic
995199421 5:109410056-109410078 GTCATCTCTGCTATGGGGGAGGG - Intergenic
999438355 5:151581829-151581851 GTGATCCCTGATATGGGGGAGGG - Intergenic
1001900388 5:175422191-175422213 GTGGGCCCTGGGATGGGGGAGGG - Intergenic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1008565258 6:52761956-52761978 GTGAGCACAGGGCTGGGGGTAGG - Intronic
1010017948 6:71126066-71126088 GAGAGCTCTGTGGTGGGGGAAGG + Intergenic
1010066304 6:71686342-71686364 CTGAGCCCTGCCCTGGGGGAAGG - Intergenic
1010732759 6:79408595-79408617 GTGACCACTGCTTTTGGGGAGGG + Intergenic
1019563973 7:1670675-1670697 GTGCGGACGGCGAAGGGGGACGG - Intergenic
1021798903 7:24284770-24284792 GTGACGACTGCGGTGGGGAAGGG - Intronic
1022041271 7:26583804-26583826 GTGAGCACTGCAAAGCAGGACGG - Intergenic
1023375447 7:39551007-39551029 GTGAGCACAGGCATGGGTGATGG - Intergenic
1024797666 7:53037390-53037412 GTTAGCACTGGGAAAGGGGAAGG + Intergenic
1025853698 7:65260993-65261015 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
1026492443 7:70874416-70874438 GGGAGCACTGGGATGGTGGCAGG - Intergenic
1026765211 7:73155589-73155611 GAGGGGGCTGCGATGGGGGAGGG - Intergenic
1026827806 7:73595241-73595263 GGGAGCTCAGGGATGGGGGATGG - Intronic
1027041685 7:74965345-74965367 GAGGGGGCTGCGATGGGGGAGGG - Intronic
1027081957 7:75237024-75237046 GAGGGGGCTGCGATGGGGGAGGG + Intergenic
1030117141 7:106070591-106070613 GTAGGCACTGCACTGGGGGAAGG - Intergenic
1030714121 7:112789150-112789172 GTGAGCACTGGGGTGGGGCCAGG - Intronic
1031230658 7:119101062-119101084 GTGAGCACAGGGTTGGGGGTAGG + Intergenic
1031871338 7:127091966-127091988 ATGATCAGTGGGATGGGGGATGG - Intronic
1034777909 7:153848260-153848282 GTGAGGACTGGGGTGGGGGTAGG - Intergenic
1034985640 7:155512459-155512481 GTGAGCAATGGAATGGGGGTGGG + Intronic
1035028493 7:155842684-155842706 GTCAGCACTGAGATGGGGGCAGG + Intergenic
1035312124 7:157976039-157976061 GTGAGCACTCAGGTGAGGGAGGG - Intronic
1036687983 8:10924480-10924502 GTCAGCACTGCACTGGGGGCCGG + Intronic
1044894686 8:96878945-96878967 GAGAGCACTGTGGTGTGGGAGGG + Intronic
1048294202 8:133202666-133202688 CTGGGCAGTGCGGTGGGGGAAGG + Intronic
1048471357 8:134707060-134707082 GTGAGCACTGAGTTTGGGGAGGG - Intronic
1048848747 8:138624134-138624156 GTGAGCACAGTGATGGGTGAGGG + Intronic
1049377466 8:142296048-142296070 GTGATGACTGTCATGGGGGAAGG + Intronic
1049377579 8:142296369-142296391 GTGGTCACTGTCATGGGGGAGGG + Intronic
1049377591 8:142296415-142296437 GTGGTCACTGTCATGGGGGAGGG + Intronic
1049481893 8:142828969-142828991 GTGAGCACAGGGTTGGGGGTAGG - Intergenic
1051410695 9:16786854-16786876 GTGAGTTTTGGGATGGGGGAAGG - Intronic
1052689824 9:31802682-31802704 GTGAGGACTGAGATTTGGGAGGG + Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1053351876 9:37418539-37418561 GTGTGCATTGCTTTGGGGGAGGG - Intergenic
1057143795 9:92745258-92745280 GGGCACACTGGGATGGGGGATGG + Intronic
1059107668 9:111525399-111525421 GTGCGCACTCCGCTGCGGGATGG + Intronic
1059360684 9:113739792-113739814 GTGAGCACTGGGATTGGAGTTGG - Intergenic
1059468790 9:114487859-114487881 GTGAGCACTCCCTTGGGAGAAGG - Intronic
1061083988 9:128388726-128388748 GTGAGCATTGCCATGTGGCATGG + Intronic
1061164707 9:128915706-128915728 GTGAGCCCTGGGATGGAGGTGGG + Intronic
1062409845 9:136418050-136418072 GTGAGCTCGGGGATGGGGGTCGG - Exonic
1062524885 9:136974183-136974205 GTGTTCACTGACATGGGGGACGG - Intergenic
1203369527 Un_KI270442v1:289810-289832 GTGAGCACAGGGTTGGGGGTAGG - Intergenic
1186294400 X:8133358-8133380 GTGAGCATGGCGGTGGGGAAGGG - Intergenic
1186450619 X:9670367-9670389 GTGAGCAGTGGGGTGGGGTAGGG - Intronic
1186638059 X:11427471-11427493 GTGGGGACTGCGAGGGGCGATGG - Intronic
1186836038 X:13439066-13439088 GGGAGCACTTGGATGGGGAAGGG + Intergenic
1187858625 X:23660684-23660706 GTGAGCACAGGGTTGGGGGTAGG + Intergenic
1188727693 X:33606497-33606519 GTGAGCAATGTGGTGGGGGGGGG + Intergenic
1189279201 X:39809340-39809362 GGGCGCACAGAGATGGGGGAGGG - Intergenic
1190044568 X:47101566-47101588 GTGGCCACTGTGAGGGGGGAAGG + Intergenic
1190687563 X:52888197-52888219 GGGAGCAATGAGGTGGGGGAGGG - Intergenic
1190698419 X:52967595-52967617 GGGAGCAATGAGGTGGGGGAGGG + Intronic
1192429898 X:71104746-71104768 GTAAGAAGTGAGATGGGGGAGGG - Intronic
1194861088 X:98999597-98999619 GTGAGCATTGAGATTTGGGAGGG + Intergenic
1195210685 X:102650964-102650986 GTCAGCACTGCAGTGTGGGAGGG - Intergenic
1195216828 X:102711929-102711951 GTCAGCACTGCAGTGTGGGAGGG - Intergenic
1201604953 Y:15773985-15774007 GTGAGCACAGTGTTGGGGGTAGG + Intergenic