ID: 1182659108

View in Genome Browser
Species Human (GRCh38)
Location 22:31912583-31912605
Sequence CCATGGGGATGAGGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182659098_1182659108 -2 Left 1182659098 22:31912562-31912584 CCAACAAGAAAATCTCTTTTCCC No data
Right 1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG No data
1182659097_1182659108 2 Left 1182659097 22:31912558-31912580 CCTTCCAACAAGAAAATCTCTTT No data
Right 1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG No data
1182659096_1182659108 24 Left 1182659096 22:31912536-31912558 CCTCAGTGAATCAGCACATAGTC No data
Right 1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182659108 Original CRISPR CCATGGGGATGAGGGGAGAT GGG Intergenic
No off target data available for this crispr