ID: 1182661311

View in Genome Browser
Species Human (GRCh38)
Location 22:31927222-31927244
Sequence TGCCATGGCAACAGAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182661306_1182661311 -7 Left 1182661306 22:31927206-31927228 CCAGGCTGTGCTGCAGTGCCATG No data
Right 1182661311 22:31927222-31927244 TGCCATGGCAACAGAGGCAGGGG No data
1182661304_1182661311 6 Left 1182661304 22:31927193-31927215 CCTTCCTGATTGGCCAGGCTGTG No data
Right 1182661311 22:31927222-31927244 TGCCATGGCAACAGAGGCAGGGG No data
1182661305_1182661311 2 Left 1182661305 22:31927197-31927219 CCTGATTGGCCAGGCTGTGCTGC No data
Right 1182661311 22:31927222-31927244 TGCCATGGCAACAGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182661311 Original CRISPR TGCCATGGCAACAGAGGCAG GGG Intergenic
No off target data available for this crispr