ID: 1182663426

View in Genome Browser
Species Human (GRCh38)
Location 22:31941255-31941277
Sequence CTGTAAAACGGGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182663421_1182663426 8 Left 1182663421 22:31941224-31941246 CCATGGGACAGCTCTGTGTCAGT 0: 1
1: 0
2: 2
3: 25
4: 185
Right 1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG 0: 1
1: 0
2: 3
3: 31
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182663426 Original CRISPR CTGTAAAACGGGAAGGAGGC CGG Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
902643905 1:17784704-17784726 CTATAAAACGGGAAGAAGCGTGG - Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902946589 1:19845027-19845049 CTGTAACACGGGGCCGAGGCTGG - Intergenic
903646064 1:24897178-24897200 CTGTCAAATGGGACGGGGGCAGG - Intergenic
903959372 1:27047116-27047138 CTGTAAAATGGGAATGAAGCCGG - Intergenic
903997570 1:27317206-27317228 CTATAAAATGGAATGGAGGCCGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904690442 1:32289852-32289874 TTATAAAATGGGGAGGAGGCCGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
906953141 1:50350441-50350463 CTGTGATATGGAAAGGAGGCAGG + Intergenic
908605668 1:65793903-65793925 GTGAAAAACGGGAAGGAAGGAGG - Intronic
911462224 1:98205515-98205537 TTGTAAAACTGGAAAGAGGCTGG + Intergenic
913286380 1:117230433-117230455 CTGTAAAATGGGAATGAGCATGG + Intergenic
913524333 1:119676619-119676641 CTGAAAGACAGGAAAGAGGCCGG - Intronic
915938755 1:160104937-160104959 CTGTAGGGCGGGAAGGACGCTGG + Intergenic
917783026 1:178419773-178419795 TGGTAAAACTGGCAGGAGGCAGG + Intronic
917832318 1:178905209-178905231 CTTTGATATGGGAAGGAGGCTGG - Intronic
918909765 1:190551843-190551865 TTGTAAAACTGGCAGGAGGCTGG + Intergenic
919742498 1:200989379-200989401 GTGTAACTCTGGAAGGAGGCAGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
922072148 1:222205013-222205035 CTGTAGTAGGGAAAGGAGGCTGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064578914 10:16773633-16773655 CTGTATTACGTGGAGGAGGCAGG - Intronic
1064999913 10:21328989-21329011 CCTTAAAAAAGGAAGGAGGCCGG - Intergenic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065955575 10:30690886-30690908 CAGTAAAACGGGAGAGAGGGAGG - Intergenic
1066018214 10:31269672-31269694 CTATAAAGAGGGAAGGAGGTAGG - Intergenic
1069421620 10:68251442-68251464 CTGTTAAAAGGGAATGAGGGCGG + Intergenic
1070371068 10:75782536-75782558 CTGTGAAGCGGAAAGGAGGCCGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070594403 10:77821908-77821930 CTGGAAGACAGGAAGGAGCCAGG - Exonic
1070704370 10:78627050-78627072 CTGTAGACAGGGAAGTAGGCAGG - Intergenic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071794443 10:88990392-88990414 CTTTAGAAAGGGCAGGAGGCCGG + Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072812876 10:98477157-98477179 CTCTAAAATGGAAGGGAGGCAGG + Intronic
1077092056 11:783073-783095 CTGGAAAACGGGAAAAAAGCAGG - Intronic
1077677934 11:4214166-4214188 CGGTAAGGCGGGGAGGAGGCAGG - Intergenic
1078020924 11:7655410-7655432 CTGTAAAATGGGCAGCAGCCTGG - Intronic
1079004022 11:16779967-16779989 CTCTAAAACGGGGAGGGGGGGGG + Intronic
1079041367 11:17063427-17063449 CTGTACAAAGCTAAGGAGGCAGG - Intergenic
1081774535 11:45668356-45668378 CTGTAAAACGGGAATGACATTGG - Intergenic
1082790053 11:57340883-57340905 CTCTGCAAAGGGAAGGAGGCTGG + Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087402172 11:97681672-97681694 CTGTAAAAAGACAAAGAGGCTGG - Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090477541 11:127037212-127037234 CTGTGACACAGGCAGGAGGCTGG - Intergenic
1090915603 11:131159892-131159914 CTGAAACACTGGAAGGAGACAGG + Intergenic
1092572982 12:9745469-9745491 CTGTAAAACTGGAAAGAGGCTGG + Intergenic
1095411914 12:41933745-41933767 TTGTGAAACTGGCAGGAGGCTGG - Intergenic
1095952994 12:47791585-47791607 CTGGACAACGGGAAGCTGGCAGG - Exonic
1096907560 12:54948950-54948972 TTGTAAAACTGGGAAGAGGCTGG - Intronic
1097353146 12:58571147-58571169 CTTTAAAATGGAAAAGAGGCTGG + Intronic
1098688616 12:73457843-73457865 TTGTAAAACTGACAGGAGGCTGG + Intergenic
1100603648 12:96133308-96133330 CTGGGAAGCGGGAATGAGGCTGG + Intergenic
1102001539 12:109560908-109560930 CTGCACAGCGGGCAGGAGGCAGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1103163334 12:118749421-118749443 CTGTAAAATGGGAATAAAGCTGG - Intergenic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104213733 12:126715267-126715289 CTCTAAAACGGGAATGAGGAAGG + Intergenic
1104295492 12:127508144-127508166 CTGTAAAATGGGTAGGAGGATGG + Intergenic
1106211520 13:27652446-27652468 TTGGAAAACTGGAAGGAGCCTGG - Intronic
1108382113 13:49864216-49864238 CTGGAAAACAGGATGGAGGCTGG + Intergenic
1109866987 13:68277599-68277621 TTGTAAAACTGGCCGGAGGCTGG - Intergenic
1110521101 13:76477849-76477871 TTGTAAAACTGGCAAGAGGCTGG + Intergenic
1115242167 14:31260537-31260559 CTGTCACATGGGAAGGAGACAGG - Intergenic
1115402255 14:32975321-32975343 GTCTAAAAAGGGAAGGAGGCAGG - Intronic
1116723009 14:48524848-48524870 GTGGAAAACGGGAAGAAGGGAGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1119855867 14:77900288-77900310 CTTTGAAATGGGACGGAGGCTGG + Intronic
1119921457 14:78450399-78450421 GTGTTAAATGGGATGGAGGCTGG + Intronic
1120585962 14:86312636-86312658 CTGCAAGGCGGCAAGGAGGCTGG + Intergenic
1120827761 14:88970601-88970623 CTTTAAAACAGGAGGGAGGCCGG + Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1122219942 14:100231387-100231409 CTGTAAAACAGGAATAAGCCGGG - Intergenic
1122936495 14:104960077-104960099 TTGTAAAACAAAAAGGAGGCTGG + Intronic
1124590496 15:31049343-31049365 CTAGAAAAAGGGAAGGAAGCGGG - Intronic
1125043519 15:35220583-35220605 CTGTGAAAGGGCAAAGAGGCAGG + Intronic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1128148667 15:65347377-65347399 CTGTAAAATGGGAGTGGGGCAGG + Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128741482 15:70086867-70086889 GTGCAAAAGGGGAAGAAGGCAGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129188787 15:73926069-73926091 CGGGAGTACGGGAAGGAGGCTGG + Intronic
1130402307 15:83568633-83568655 CTGAAATACGGGAAGGAGCTCGG + Exonic
1130561973 15:84965879-84965901 CTGTTAAGCTGGAGGGAGGCGGG + Intergenic
1130763846 15:86850384-86850406 GTGAAAAACAGGAAGGGGGCAGG - Intronic
1131144234 15:90001374-90001396 CTGGAAGAAGGGAATGAGGCAGG - Exonic
1134076182 16:11293072-11293094 CAGAAAAACGGGAATGTGGCTGG + Intronic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1136690014 16:32022233-32022255 CTGCACACCTGGAAGGAGGCCGG - Intergenic
1137063836 16:35815749-35815771 CTGAAAAATGGGAGGGAGACTGG + Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1138262875 16:55637972-55637994 CTGAAAAACGGGAAGGGGAATGG + Intergenic
1138491754 16:57381174-57381196 CTGTAAAATGGGGATGAGCCTGG + Intronic
1139250873 16:65494703-65494725 CTGTAAAACAGGAACCATGCAGG - Intergenic
1139939780 16:70596881-70596903 CTGTAAAATGGAAATGAGGCTGG - Intronic
1140548503 16:75836478-75836500 TTGTAAAACTGGCAAGAGGCTGG - Intergenic
1140590459 16:76345737-76345759 TTGTAAAACTGGCAAGAGGCTGG + Intronic
1140878814 16:79178611-79178633 ATGTAAAACAGGAATCAGGCTGG - Intronic
1141088457 16:81113445-81113467 CTGCAAGACTGGAGGGAGGCAGG + Intergenic
1142111241 16:88332826-88332848 CTGTGAAACGGTGAGGAGGCTGG - Intergenic
1142233715 16:88911603-88911625 CTGTAAAATGGGAATGGGGATGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142396357 16:89833895-89833917 GTAGAAAGCGGGAAGGAGGCTGG + Intronic
1142893855 17:2962339-2962361 CTGTAAAATGGGAATGATGATGG - Intronic
1142966563 17:3585548-3585570 CTGAGAAGCGGGAAGGGGGCGGG + Intronic
1143102713 17:4513161-4513183 CTGCAAGGCGGGAAAGAGGCTGG + Intronic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1147888632 17:43701514-43701536 CTGACAAACAGGAAGGTGGCAGG - Intergenic
1148804764 17:50258649-50258671 CTGTAAAATGGGATGGGGCCAGG - Intergenic
1149184957 17:53986513-53986535 TTGTAAAAGGGAAAGGAGGGAGG - Intergenic
1150691054 17:67367270-67367292 CTTGAAAATGGGAATGAGGCCGG + Intergenic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152070075 17:78129973-78129995 CTGGAAACCAGGAAGGAGGTGGG + Intronic
1153858577 18:9174804-9174826 CTGTAAGACAAGAAGGGGGCAGG - Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1155779191 18:29809992-29810014 CTGTAAAACTGGCAAGAGACTGG - Intergenic
1157733423 18:50024635-50024657 CTGTAATAGGGGCAGGAGCCAGG + Intronic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1161656334 19:5517799-5517821 CTGTACAAAGGAAAGGTGGCCGG + Intergenic
1161713211 19:5861631-5861653 CTGAAGAACGGGAACTAGGCAGG - Intergenic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1162836192 19:13319834-13319856 CTGTAAAATGGGGATGACGCTGG - Intronic
1163720071 19:18894619-18894641 CTGGAAACTGGGAAGAAGGCAGG + Intronic
1164821007 19:31251266-31251288 CTCTGAAATGGGAAGGATGCAGG - Intergenic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1167241953 19:48349283-48349305 TGGTGAAAAGGGAAGGAGGCAGG - Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1168654909 19:58120138-58120160 CTTTAAAACTGGAAAGGGGCTGG - Intergenic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
930388940 2:50736111-50736133 CTGAAATACGGGAAGCAGGGGGG - Intronic
930430926 2:51275032-51275054 TTGTAAAACAGGCAAGAGGCTGG + Intergenic
932010257 2:67970451-67970473 CTTTTAAAGGGAAAGGAGGCTGG + Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932624240 2:73284822-73284844 CTGTGAATCCGGAAGGGGGCGGG + Intergenic
933497502 2:83067994-83068016 TTGTAAAACGGGTAAGAGGCTGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939495488 2:142923021-142923043 TTGTAAAACAGGTGGGAGGCAGG - Intronic
941039847 2:160608930-160608952 CTGCAAAACATGAAGCAGGCAGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942713470 2:178864582-178864604 CTGTTAAACAGGAGGGAAGCAGG - Intronic
943401135 2:187412140-187412162 TTCTAAAACTGGAAGGATGCAGG - Intronic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944013710 2:195006201-195006223 TTGTAAAACTGGCAAGAGGCTGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
948281538 2:236751051-236751073 CTATAAACCGGAAAGCAGGCAGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172440801 20:34965185-34965207 CTATAAAACAGGAATGAGCCAGG - Intergenic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1174406649 20:50307135-50307157 CTGTAAAATGGGGAGGATCCTGG + Intergenic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1176096613 20:63347272-63347294 CTGCAAAACGGGGAGGGGGATGG - Intronic
1176821620 21:13663944-13663966 CTCTACAACGGGAAGGAAGGTGG - Intergenic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179593575 21:42427563-42427585 CTGTAAAATGGGTAGGGGGCAGG - Intronic
1179619144 21:42601204-42601226 CTTTAGAACAGGAAAGAGGCCGG + Intergenic
1180148519 21:45935446-45935468 CTTTAAAAAGGAAAGGAGGGAGG - Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1183391688 22:37548956-37548978 ATGTCAAGCGGGGAGGAGGCAGG + Intergenic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1184043122 22:41956305-41956327 CTATAAAATGGGAATGGGGCTGG - Intergenic
1184458793 22:44625739-44625761 CTGTAAAATGGGGATGAGGCTGG + Intergenic
1184484376 22:44767215-44767237 CGGGAAAGCGGGAAGGAGGGAGG - Intronic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
949254538 3:2030149-2030171 ATGCAAAAAGGGATGGAGGCAGG + Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
949830597 3:8210254-8210276 CTGTAAAAGGGGCAGAGGGCTGG - Intergenic
950125870 3:10509476-10509498 CTGTAAAATGGGAAGAAGCCTGG - Intronic
953827160 3:46263618-46263640 CTGTAAAACTGGTAGGAAGCAGG - Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955352095 3:58201110-58201132 CTGAGAAACAGGAAAGAGGCGGG + Intronic
955985471 3:64569266-64569288 TTGTAAAACAGGCAAGAGGCTGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961406886 3:126685926-126685948 CTTTAAAAGTGGAAGCAGGCTGG + Intergenic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962743542 3:138381067-138381089 CTTTAAAACGGAGAGAAGGCCGG - Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
965065360 3:163840991-163841013 CTGTGAAACAGACAGGAGGCTGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968103622 3:195985527-195985549 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
968301924 3:197623120-197623142 CTGGAGCACGGGGAGGAGGCAGG + Intergenic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
974766561 4:66354693-66354715 ATATAAAAAGTGAAGGAGGCTGG - Intergenic
977280398 4:95032427-95032449 CTGTAACACGGGAAGTAGGGAGG + Intronic
977942514 4:102874322-102874344 CTGCTAAAGGGGAGGGAGGCAGG + Intronic
980487284 4:133474729-133474751 TTGTAAAACTGGCAGGAGGCTGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981561831 4:146056436-146056458 CTGTAGAAAGGGATGCAGGCTGG + Intergenic
986180221 5:5386082-5386104 CTCTAGAACGGGAGGCAGGCAGG + Intergenic
986243042 5:5978712-5978734 CTGTATCACGGGTGGGAGGCTGG - Intergenic
990709639 5:58565760-58565782 TTATAAAAGGGTAAGGAGGCTGG + Intergenic
991306494 5:65181880-65181902 TTTTAAAATGTGAAGGAGGCAGG - Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
994806326 5:104451974-104451996 CTGCAAAGCGGCAACGAGGCTGG - Intergenic
995234160 5:109807227-109807249 CTGGAAAACAGGATGGAGGTGGG - Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
996203878 5:120707035-120707057 TTGTAAAACTGGAAAGAGGCTGG + Intergenic
997043575 5:130286508-130286530 GTGTAAAACTGGCAAGAGGCTGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997529872 5:134575418-134575440 CAGAGAAACTGGAAGGAGGCTGG + Intronic
997530172 5:134577110-134577132 CTGTAGACCTGGATGGAGGCTGG + Intronic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999684391 5:154089245-154089267 CAATAGAACGGGAAGAAGGCAGG - Intronic
999686720 5:154109773-154109795 CTGTAAAATGGGAATTAGGATGG - Intronic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001433720 5:171683270-171683292 CTGCAAAACAGGAAGGATGGAGG + Intergenic
1002858510 6:1058929-1058951 GTGTCAAAAGGGAAGGAGGCCGG + Intergenic
1004037693 6:11939838-11939860 CTGTCTAACTGCAAGGAGGCTGG - Intergenic
1004100082 6:12600473-12600495 CAATAAAAAGGGAAGGGGGCCGG + Intergenic
1005458254 6:26042706-26042728 CTGTAACAAAGGAAGAAGGCAGG + Intergenic
1005532496 6:26722040-26722062 CTGTAATACGGCAAGGGGGTTGG - Intergenic
1005538299 6:26779625-26779647 CTGTAATACGGCAAGGGGGTTGG + Intergenic
1006922912 6:37638182-37638204 GTGCAAGACGGGAAGGAGGTGGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009006938 6:57799213-57799235 CTGTAATACGGCAAGGGGGTTGG + Intergenic
1009009151 6:57821975-57821997 CTGTAATACGGCAAGGGGGTTGG + Intergenic
1009753822 6:67909026-67909048 CTTTAAAACAGGAAGGAGAAAGG - Intergenic
1010142228 6:72624062-72624084 TTGTAAAACGGAAAGTTGGCTGG - Intronic
1011803296 6:91042929-91042951 CCTTAAAGCGGGAAGGAGGATGG + Intergenic
1013952631 6:115802949-115802971 CTGTAAAACTGGCAAAAGGCTGG + Intergenic
1013952873 6:115806111-115806133 CTGTAAAACTGGCAAAAGGCTGG + Intergenic
1015758475 6:136632116-136632138 CTGGAAAGTGGAAAGGAGGCTGG + Intronic
1018523261 6:164677276-164677298 CTGTAAAACTGGAAATACGCTGG + Intergenic
1018545273 6:164928861-164928883 GTGTAAAACAGGAGGTAGGCAGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1021451478 7:20786492-20786514 CTGTAAAATGGGCTGGACGCAGG + Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1022474080 7:30699158-30699180 CTGTAAAATGGGGAGAAGGCTGG + Intronic
1023002308 7:35822788-35822810 CAGTAAAACTGTAAGGAAGCAGG - Intronic
1023322905 7:39018945-39018967 CTGCAATACAAGAAGGAGGCAGG - Intronic
1023613045 7:41990955-41990977 CTGGAAGAAAGGAAGGAGGCAGG + Intronic
1024152613 7:46588292-46588314 CTGAAAAACGGGGATGAGCCAGG + Intergenic
1030497176 7:110314770-110314792 TTGTAAAACTGGAAAGAGGCTGG - Intergenic
1032408483 7:131675126-131675148 GTGTAAGATGGGCAGGAGGCAGG - Intergenic
1033315987 7:140297955-140297977 CTTTAAAAAAGGAAGGGGGCTGG + Intronic
1033896208 7:146073899-146073921 CAGTAATACGGGAAGGGGGCAGG + Intergenic
1034687798 7:152988913-152988935 TTGTAAAACTGGCAAGAGGCTGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037274119 8:17159159-17159181 CTGTGAAAAGGAAAGGAGTCTGG - Intronic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1038538383 8:28371058-28371080 CTGTAAAATGGGAATGATGATGG - Intronic
1038586493 8:28794270-28794292 ATCTAAAACGGGAAGGAGCTTGG - Intronic
1039052147 8:33504924-33504946 CTGTAAAAAGAAAAAGAGGCTGG + Intronic
1039548021 8:38423599-38423621 TTGTAAAAGGGAAAGAAGGCCGG - Intronic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1041967608 8:63698209-63698231 CTGTAAAATGGAGATGAGGCTGG + Intergenic
1046643265 8:116755923-116755945 CTGGAAAACAGGAGGGAGGCGGG - Intronic
1046657191 8:116907655-116907677 CTGTAAAATGGGAATGATGATGG - Intergenic
1047059610 8:121209854-121209876 TTGTAAGGAGGGAAGGAGGCAGG + Intergenic
1047206774 8:122808728-122808750 CTGTAAATCTGGAAGGAGTGTGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048861846 8:138729636-138729658 CTGTAAATTGGAAAAGAGGCTGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050824704 9:9931624-9931646 CTGCAAGACGGCAACGAGGCTGG + Intronic
1051026888 9:12623796-12623818 CTAGAAAATGGGAAGGAGTCAGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052202683 9:25801915-25801937 TTGTAAAACTGGAAAGAGGTTGG + Intergenic
1053442375 9:38127040-38127062 CTCTAGAACTGGAAGGATGCAGG - Intergenic
1054813594 9:69454262-69454284 TTGTAAAACTGGAAGGAGTAAGG + Intronic
1057698416 9:97344289-97344311 ATGTAACATGGGCAGGAGGCTGG + Intronic
1060666357 9:125434270-125434292 CTGTAAAATGGGAATTAGGTGGG + Intergenic
1061516756 9:131094625-131094647 CTGAGAAACTGGAGGGAGGCGGG - Intergenic
1062313130 9:135950306-135950328 CTCTAACACGGGAAAGAGGCAGG + Intronic
1062341910 9:136097503-136097525 CTGTAAAACGGGAATAAGGCTGG - Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1188852225 X:35145853-35145875 CTGTAAAAAGTGAAAGAAGCAGG + Intergenic
1192145333 X:68678362-68678384 GAGTAAAAAGGGAAGGAGGAAGG + Intronic
1194336057 X:92647533-92647555 TTGTACACAGGGAAGGAGGCAGG - Intergenic
1195742106 X:108075319-108075341 CTCAGAAACGGGAAGGAGTCGGG + Intronic
1197817964 X:130517786-130517808 CTGCAAGGCGGCAAGGAGGCTGG + Intergenic
1199061392 X:143359249-143359271 CTGAAAAATGGGAAACAGGCTGG + Intergenic
1200644489 Y:5764276-5764298 TTGTACACAGGGAAGGAGGCAGG - Intergenic
1200932193 Y:8707102-8707124 CTGTAGGATGCGAAGGAGGCAGG - Intergenic
1200940956 Y:8781264-8781286 CTTTAAAACAGGTATGAGGCAGG + Intergenic
1201627090 Y:16026461-16026483 CTGCAAGACGGCAATGAGGCTGG + Intergenic
1201698550 Y:16854353-16854375 CTGTCAAACAGGAAGGATGGAGG - Intergenic