ID: 1182666059

View in Genome Browser
Species Human (GRCh38)
Location 22:31960872-31960894
Sequence AAGAAATGGACTTTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182666059_1182666066 -8 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666066 22:31960887-31960909 CATTTCTTTGAGTTGGGGGAAGG No data
1182666059_1182666068 -6 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666068 22:31960889-31960911 TTTCTTTGAGTTGGGGGAAGGGG No data
1182666059_1182666071 25 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666071 22:31960920-31960942 TTGATAATGAAGCTATTGTTGGG No data
1182666059_1182666069 -2 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666069 22:31960893-31960915 TTTGAGTTGGGGGAAGGGGTAGG No data
1182666059_1182666067 -7 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666067 22:31960888-31960910 ATTTCTTTGAGTTGGGGGAAGGG No data
1182666059_1182666070 24 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182666059 Original CRISPR AAGAAATGGACTTTTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr