ID: 1182666065

View in Genome Browser
Species Human (GRCh38)
Location 22:31960886-31960908
Sequence CTTCCCCCAACTCAAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182666065_1182666071 11 Left 1182666065 22:31960886-31960908 CCATTTCTTTGAGTTGGGGGAAG No data
Right 1182666071 22:31960920-31960942 TTGATAATGAAGCTATTGTTGGG No data
1182666065_1182666072 22 Left 1182666065 22:31960886-31960908 CCATTTCTTTGAGTTGGGGGAAG No data
Right 1182666072 22:31960931-31960953 GCTATTGTTGGGTAAATTCTTGG No data
1182666065_1182666070 10 Left 1182666065 22:31960886-31960908 CCATTTCTTTGAGTTGGGGGAAG No data
Right 1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182666065 Original CRISPR CTTCCCCCAACTCAAAGAAA TGG (reversed) Intergenic
No off target data available for this crispr