ID: 1182666068

View in Genome Browser
Species Human (GRCh38)
Location 22:31960889-31960911
Sequence TTTCTTTGAGTTGGGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182666058_1182666068 1 Left 1182666058 22:31960865-31960887 CCTCAAACCCTGCTCAAAAGTCC No data
Right 1182666068 22:31960889-31960911 TTTCTTTGAGTTGGGGGAAGGGG No data
1182666057_1182666068 10 Left 1182666057 22:31960856-31960878 CCAGTAGCTCCTCAAACCCTGCT No data
Right 1182666068 22:31960889-31960911 TTTCTTTGAGTTGGGGGAAGGGG No data
1182666059_1182666068 -6 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666068 22:31960889-31960911 TTTCTTTGAGTTGGGGGAAGGGG No data
1182666060_1182666068 -7 Left 1182666060 22:31960873-31960895 CCTGCTCAAAAGTCCATTTCTTT No data
Right 1182666068 22:31960889-31960911 TTTCTTTGAGTTGGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182666068 Original CRISPR TTTCTTTGAGTTGGGGGAAG GGG Intergenic
No off target data available for this crispr