ID: 1182666070

View in Genome Browser
Species Human (GRCh38)
Location 22:31960919-31960941
Sequence CTTGATAATGAAGCTATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182666060_1182666070 23 Left 1182666060 22:31960873-31960895 CCTGCTCAAAAGTCCATTTCTTT No data
Right 1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG No data
1182666065_1182666070 10 Left 1182666065 22:31960886-31960908 CCATTTCTTTGAGTTGGGGGAAG No data
Right 1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG No data
1182666059_1182666070 24 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182666070 Original CRISPR CTTGATAATGAAGCTATTGT TGG Intergenic
No off target data available for this crispr