ID: 1182666071

View in Genome Browser
Species Human (GRCh38)
Location 22:31960920-31960942
Sequence TTGATAATGAAGCTATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182666059_1182666071 25 Left 1182666059 22:31960872-31960894 CCCTGCTCAAAAGTCCATTTCTT No data
Right 1182666071 22:31960920-31960942 TTGATAATGAAGCTATTGTTGGG No data
1182666065_1182666071 11 Left 1182666065 22:31960886-31960908 CCATTTCTTTGAGTTGGGGGAAG No data
Right 1182666071 22:31960920-31960942 TTGATAATGAAGCTATTGTTGGG No data
1182666060_1182666071 24 Left 1182666060 22:31960873-31960895 CCTGCTCAAAAGTCCATTTCTTT No data
Right 1182666071 22:31960920-31960942 TTGATAATGAAGCTATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182666071 Original CRISPR TTGATAATGAAGCTATTGTT GGG Intergenic
No off target data available for this crispr