ID: 1182668302

View in Genome Browser
Species Human (GRCh38)
Location 22:31974825-31974847
Sequence CTGAATGATGAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182668299_1182668302 -10 Left 1182668299 22:31974812-31974834 CCACTCTGGAGACCTGAATGATG No data
Right 1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182668302 Original CRISPR CTGAATGATGAGAAGGAGCC AGG Intergenic
No off target data available for this crispr