ID: 1182670315

View in Genome Browser
Species Human (GRCh38)
Location 22:31990335-31990357
Sequence CTTTCTATTCTCTAGGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182670307_1182670315 17 Left 1182670307 22:31990295-31990317 CCCTGTGCAGTTCATATAATAAA No data
Right 1182670315 22:31990335-31990357 CTTTCTATTCTCTAGGGGGTAGG No data
1182670308_1182670315 16 Left 1182670308 22:31990296-31990318 CCTGTGCAGTTCATATAATAAAG No data
Right 1182670315 22:31990335-31990357 CTTTCTATTCTCTAGGGGGTAGG No data
1182670306_1182670315 28 Left 1182670306 22:31990284-31990306 CCTGTGCTGAGCCCTGTGCAGTT No data
Right 1182670315 22:31990335-31990357 CTTTCTATTCTCTAGGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182670315 Original CRISPR CTTTCTATTCTCTAGGGGGT AGG Intergenic
No off target data available for this crispr