ID: 1182670315 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:31990335-31990357 |
| Sequence | CTTTCTATTCTCTAGGGGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182670307_1182670315 | 17 | Left | 1182670307 | 22:31990295-31990317 | CCCTGTGCAGTTCATATAATAAA | No data | ||
| Right | 1182670315 | 22:31990335-31990357 | CTTTCTATTCTCTAGGGGGTAGG | No data | ||||
| 1182670308_1182670315 | 16 | Left | 1182670308 | 22:31990296-31990318 | CCTGTGCAGTTCATATAATAAAG | No data | ||
| Right | 1182670315 | 22:31990335-31990357 | CTTTCTATTCTCTAGGGGGTAGG | No data | ||||
| 1182670306_1182670315 | 28 | Left | 1182670306 | 22:31990284-31990306 | CCTGTGCTGAGCCCTGTGCAGTT | No data | ||
| Right | 1182670315 | 22:31990335-31990357 | CTTTCTATTCTCTAGGGGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182670315 | Original CRISPR | CTTTCTATTCTCTAGGGGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||