ID: 1182674899

View in Genome Browser
Species Human (GRCh38)
Location 22:32031512-32031534
Sequence GCTGAGAAGCAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182674899_1182674908 17 Left 1182674899 22:32031512-32031534 CCCTCCCCTCTCTGCTTCTCAGC No data
Right 1182674908 22:32031552-32031574 TTCCTAATTCCTCAGCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182674899 Original CRISPR GCTGAGAAGCAGAGAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr