ID: 1182675888

View in Genome Browser
Species Human (GRCh38)
Location 22:32039540-32039562
Sequence GAAAAGTACTACACACGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 2, 2: 4, 3: 9, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182675885_1182675888 -9 Left 1182675885 22:32039526-32039548 CCCGGGTCATCATAGAAAAGTAC No data
Right 1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG 0: 1
1: 2
2: 4
3: 9
4: 64
1182675878_1182675888 23 Left 1182675878 22:32039494-32039516 CCGCGTTTGCACCAAAACCGTGA 0: 1
1: 2
2: 1
3: 4
4: 24
Right 1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG 0: 1
1: 2
2: 4
3: 9
4: 64
1182675886_1182675888 -10 Left 1182675886 22:32039527-32039549 CCGGGTCATCATAGAAAAGTACT No data
Right 1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG 0: 1
1: 2
2: 4
3: 9
4: 64
1182675884_1182675888 6 Left 1182675884 22:32039511-32039533 CCGTGAAGAAGGCGGCCCGGGTC No data
Right 1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG 0: 1
1: 2
2: 4
3: 9
4: 64
1182675881_1182675888 12 Left 1182675881 22:32039505-32039527 CCAAAACCGTGAAGAAGGCGGCC No data
Right 1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG 0: 1
1: 2
2: 4
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182675888 Original CRISPR GAAAAGTACTACACACGCCT GGG Intergenic
907372579 1:54012860-54012882 GAAAAGGAATACCCACTCCTAGG + Intronic
909949747 1:81705324-81705346 GAAAAATAATACACAGGGCTGGG - Intronic
916687779 1:167162764-167162786 GAAAAGTACTACACGCGCCTGGG - Intergenic
917051067 1:170924192-170924214 GAAAAGAACAACACACACTTGGG + Intergenic
921345855 1:214184516-214184538 GAAAAGCACAAGACATGCCTGGG + Intergenic
1065707349 10:28482737-28482759 GAAGAGTACTACAAAACCCTTGG + Intergenic
1066269754 10:33810769-33810791 GAAATGTACTTCACAAGCTTGGG + Intergenic
1067137795 10:43626597-43626619 AAAAAGTAATACACAAGTCTGGG - Intergenic
1068156501 10:53205992-53206014 AAAAAGAACTACCCAAGCCTGGG - Intergenic
1069387694 10:67899370-67899392 GAAAGATACTGCACACGTCTGGG - Intronic
1069943988 10:71973506-71973528 GAACAGTTCTACCCACCCCTGGG - Intronic
1078512022 11:11991774-11991796 ATAAAGTAGTACACAAGCCTGGG - Intronic
1081511222 11:43775338-43775360 GAAAAGTAATACATACTCCTAGG + Intronic
1083362680 11:62122048-62122070 GAAAAATACTACAGACGACCTGG + Intergenic
1089982122 11:122781028-122781050 GAAAAGCACCACACAGGACTTGG + Intronic
1092757039 12:11773619-11773641 GAAAAGTGCTTCAAACACCTTGG - Intronic
1097889680 12:64765195-64765217 GAAAATTACTACACAGGGCCGGG + Intergenic
1098182514 12:67862953-67862975 GATAATTAGTACACAGGCCTAGG + Intergenic
1098203087 12:68078029-68078051 GAAAAATACAACACAAACCTTGG - Intergenic
1104080482 12:125426032-125426054 GAAAAATGCTACACCCGCTTTGG - Intronic
1115072509 14:29341585-29341607 GAAACGTATTACAAAAGCCTAGG + Intergenic
1122850205 14:104523976-104523998 GAAAAGTCCCACACAAGCCATGG + Intronic
1126115832 15:45206819-45206841 GAAAAGTACTATGCATGCCTTGG - Intergenic
1127753679 15:62068966-62068988 CATATGTACCACACACGCCTAGG + Exonic
1129360771 15:75022573-75022595 AAAAAGTAATACACACACCCGGG + Intergenic
1129453184 15:75662118-75662140 CAAAAGTTCTACACATCCCTGGG - Exonic
1130210932 15:81920635-81920657 GAAAATTACTGCACATGCCCAGG + Intergenic
1130283871 15:82540062-82540084 GAAAAGTACTACACGCGCCTGGG - Exonic
1139784607 16:69382313-69382335 GGAAAATTCTACAGACGCCTAGG - Intronic
1145786831 17:27599092-27599114 GTATAGTCCTCCACACGCCTCGG + Intronic
1146198178 17:30830957-30830979 GAAAAGTACTACATGCGCCTGGG + Intergenic
1155432719 18:25777753-25777775 GAAAGGAACTACACACACCAGGG + Intergenic
1158978424 18:62734995-62735017 GAAAAGTTCTACAAACATCTTGG + Intronic
1161247771 19:3263607-3263629 TAAAAGTACTACACACGGCCGGG + Intronic
1162691633 19:12438702-12438724 GAAACGTACTACACAAGCTCTGG + Intronic
935890866 2:107676245-107676267 AAAAAGTAATACATATGCCTTGG + Intergenic
937372503 2:121310047-121310069 GAAAAGCACTACATGAGCCTGGG + Intergenic
939407589 2:141778615-141778637 GAAACGTATTACACACACCATGG - Intronic
939793039 2:146604436-146604458 TAAAAGTGCTACACACCCCACGG - Intergenic
943521523 2:188957246-188957268 GAAAAATAATACACAGGTCTTGG + Intergenic
946125491 2:217558924-217558946 GAAATGAAATACACACTCCTCGG - Intronic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1174001081 20:47375271-47375293 GAAAAGTCCTGCAAACACCTGGG - Intergenic
1175514556 20:59560704-59560726 GAAGAGGACTACAGATGCCTGGG - Intergenic
1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG + Intergenic
953236185 3:41109686-41109708 GTAAAGTAGTACCCATGCCTGGG - Intergenic
959889833 3:111542127-111542149 GAACTCTACCACACACGCCTGGG - Exonic
962900486 3:139757178-139757200 GAAGAGTTCTCCATACGCCTTGG - Intergenic
963325319 3:143856070-143856092 GAAAAGTACTGCACGCGCCTAGG - Intergenic
972666419 4:41169284-41169306 GAAAAGTACAACACAGGCAAAGG + Intronic
977303477 4:95295322-95295344 GAAAACTACCAGACCCGCCTAGG + Intronic
979367667 4:119844635-119844657 GTCAAGTAATCCACACGCCTTGG + Intergenic
986657494 5:10030137-10030159 GAAAAGAAGGACACAGGCCTGGG - Intergenic
990662964 5:58039077-58039099 GAAAAGAACTACAGAAGCATTGG + Intergenic
995654972 5:114415815-114415837 GAAAATTACAACACAAGCCATGG - Intronic
995868267 5:116716294-116716316 GAAAAGTACTACATGTGCCTGGG + Intergenic
1005807641 6:29489603-29489625 GAAAAGTACTACATGTGCCTGGG - Intergenic
1006873697 6:37276955-37276977 GAAAAATACAACACACACCCTGG + Intronic
1008383255 6:50857589-50857611 GAAAAGTACTACATGCACCTGGG - Intergenic
1010557014 6:77294683-77294705 GAAATGTACAAGACAAGCCTGGG + Intergenic
1011852059 6:91641204-91641226 GAAAACTACTGCACATGCCTGGG + Intergenic
1014018327 6:116560569-116560591 AAAAGGTAGTACACACCCCTGGG + Intergenic
1015761038 6:136661341-136661363 AAAAAATATTACACACGCATAGG + Intronic
1017092542 6:150773236-150773258 GAAAAGTACTTCTCTCGGCTGGG + Intronic
1023142559 7:37116829-37116851 GAAAAGTACTACATGTGCCTCGG + Intronic
1024242644 7:47447494-47447516 GAAAGGTCCTCCACTCGCCTAGG + Intronic
1034195766 7:149245870-149245892 GAAAAATACTACACACTCTTAGG - Intronic
1037394757 8:18430047-18430069 GAAAATTACTAGACATGCCAAGG + Intergenic
1038170462 8:25127105-25127127 GAAAACTACTACACATGCAAAGG + Intergenic
1041219044 8:55630790-55630812 AAAAAGTACAACACAAGGCTGGG - Intergenic
1041640968 8:60201229-60201251 GAAAAGTTCTACAGACAGCTGGG + Intronic
1045983560 8:108220859-108220881 TAAAAGTACTACACATGCCTGGG + Intronic
1045997421 8:108379472-108379494 GAAAAGTACTACACGTGCCTGGG - Intronic
1046669580 8:117042969-117042991 GAATAGTACTACATTAGCCTGGG - Intronic
1055607676 9:77987873-77987895 GAAAAATACTAAAAACACCTAGG + Intronic
1057190316 9:93083564-93083586 TAAAAGTAGTACCCACCCCTAGG - Intronic
1058647961 9:107148223-107148245 AAAAAGTACTACACAATCTTTGG - Intergenic
1059327722 9:113514478-113514500 GGGAAGTCCTACACAGGCCTGGG + Exonic
1187056784 X:15748212-15748234 GAAAAATACTACATAGGACTAGG - Intronic
1190175088 X:48141936-48141958 GGAAAGTACTGAACACGCTTAGG + Intergenic