ID: 1182677749

View in Genome Browser
Species Human (GRCh38)
Location 22:32053086-32053108
Sequence CTGGACTCCTTGGTAAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182677744_1182677749 -6 Left 1182677744 22:32053069-32053091 CCCAATTTCAGCCCACACTGGAC No data
Right 1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG 0: 1
1: 1
2: 1
3: 11
4: 128
1182677745_1182677749 -7 Left 1182677745 22:32053070-32053092 CCAATTTCAGCCCACACTGGACT 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG 0: 1
1: 1
2: 1
3: 11
4: 128
1182677742_1182677749 8 Left 1182677742 22:32053055-32053077 CCTTAATCAGAGTTCCCAATTTC 0: 1
1: 0
2: 0
3: 7
4: 195
Right 1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG 0: 1
1: 1
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182677749 Original CRISPR CTGGACTCCTTGGTAAAGTT TGG Intronic
902328466 1:15718162-15718184 CTGGGCTCCTGGGTACAGTCTGG + Intronic
904445370 1:30569476-30569498 CTGGAGTCCATGATTAAGTTCGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
924493127 1:244559536-244559558 TTGGACTCCTTGATGAAATTAGG + Intronic
1063685629 10:8235157-8235179 TTGGAATCATTGGTAAAGTTCGG - Intergenic
1067970382 10:50963483-50963505 CTGTACACCTTGGAAAAGTCAGG + Intergenic
1073814826 10:107195128-107195150 TTGTACTCCTTGATAAAGGTAGG + Intergenic
1077138046 11:1011340-1011362 CAGGACTCCAGGGTAAAGTGTGG + Exonic
1081374625 11:42344243-42344265 CTGGACTCCTGAGTCAAGTGGGG - Intergenic
1081681540 11:45009131-45009153 CTGCCCTCCTTGGTACATTTAGG + Intergenic
1082906471 11:58312702-58312724 CTGGACTTCTGGGTCAAGTGGGG - Intergenic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1090361311 11:126174900-126174922 CTGGCCTCCTTGCTACAGTCTGG + Intergenic
1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG + Intronic
1091752310 12:3030704-3030726 CTGGACACCTGGCTAAAGGTGGG - Intronic
1092039044 12:5367328-5367350 CTGGTCTCCATGGTAAACTGTGG - Intergenic
1093243167 12:16702525-16702547 CTGGTTTCTTTGCTAAAGTTTGG - Intergenic
1094449749 12:30572112-30572134 CTTCACTACTTGGCAAAGTTTGG - Intergenic
1096383861 12:51181570-51181592 ATGTACTCCTTGGAAATGTTTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1100130280 12:91484196-91484218 CTGGACTCCTGGGTCGAGTGGGG - Intergenic
1100257525 12:92899613-92899635 CTGTCCTCATTGGGAAAGTTAGG + Intronic
1101229981 12:102730896-102730918 CTGGACTCCTGGGACAAGGTGGG + Intergenic
1105952606 13:25244451-25244473 CTGGACTTCTGGGTCAAGTGGGG - Intergenic
1107266382 13:38560982-38561004 CTGGACTCCCCAGTAAAATTGGG + Intergenic
1108714163 13:53062362-53062384 CTGTACTCCTTTGTAAAGAAAGG + Intergenic
1109456841 13:62604011-62604033 TTGGCATCCTTGGAAAAGTTGGG + Intergenic
1119179296 14:72594147-72594169 CTGGGCTCCTCTGTAAAGTAAGG - Intergenic
1120185465 14:81389316-81389338 TTGGAATCTTTGGTGAAGTTTGG - Intronic
1122683009 14:103480915-103480937 CTGGACCCTTTGGTAAACTGCGG - Intronic
1124852882 15:33358169-33358191 CTTTCCTCCTTGGTAAAGTGAGG + Intronic
1126092498 15:45064258-45064280 CAGGACACCTTGGTTAAGTCTGG + Intronic
1129853175 15:78806698-78806720 CTGTGATCCTTGGGAAAGTTAGG - Intronic
1131005972 15:88978875-88978897 CTGTACTCCTAGCTAAATTTGGG - Intergenic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1134084421 16:11346614-11346636 CTGGAGGGCTTGGTAAAGCTGGG + Intronic
1137061506 16:35794921-35794943 CCTGAATCCATGGTAAAGTTGGG - Intergenic
1140957009 16:79875259-79875281 CTCGACTCATTGGTAAAATGGGG - Intergenic
1141326702 16:83066911-83066933 CTGAACCCCTTGGTAAAGTTAGG - Intronic
1141492243 16:84381951-84381973 CTGGACTCCTTGTCAGTGTTAGG + Intronic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1144913732 17:18704753-18704775 CTGGTCTCCTTGGGTAAGCTTGG + Intronic
1146106980 17:30048081-30048103 GTGGACCACTGGGTAAAGTTAGG + Intronic
1148715250 17:49711218-49711240 CTGGTCTCTATGGTAAAGTGGGG + Exonic
1149972935 17:61237114-61237136 CTGGACTTCTGGGTAGAGTGGGG + Intronic
1150063831 17:62092027-62092049 CAGGACTCATTGGTTAGGTTGGG - Intergenic
1151082961 17:71349510-71349532 CTGGAGTGCATGGTATAGTTTGG - Intergenic
1152979601 18:263878-263900 TGGGACTTCTTGGCAAAGTTGGG + Intronic
1153272879 18:3340847-3340869 TTGGACTCCATGGGAAAGTAGGG - Intergenic
1155649423 18:28122533-28122555 TTGGACTCCATGGTAAAGAGTGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1157760555 18:50260743-50260765 AAGGAATCTTTGGTAAAGTTGGG - Intronic
1158877235 18:61745061-61745083 GTGTCCTCCTTGGTAAAGTGGGG - Intergenic
1166755400 19:45187536-45187558 CTGGTCTCCTTGGGACTGTTGGG + Intronic
1167703750 19:51066106-51066128 CTGGAGTACTTGGTATGGTTAGG - Intergenic
925216528 2:2100769-2100791 CTGGTCTCCTTAATAAAATTTGG + Intronic
926288240 2:11507783-11507805 CAGGACTCCATGGTAGAGTCGGG - Intergenic
926477595 2:13345962-13345984 CTGGAAACGTGGGTAAAGTTAGG + Intergenic
933489496 2:82967588-82967610 CTGGACTTCTGGGTCAAGTGGGG - Intergenic
940600364 2:155851108-155851130 CTGAACTCCTTGGTCAATTTAGG + Intergenic
940978817 2:159978057-159978079 TTGGAATCCTGGGTAAACTTAGG + Intronic
942674138 2:178409571-178409593 CTGAAATACTTGGTAAATTTGGG - Intergenic
942704388 2:178753299-178753321 ATGGACTTTTTGGTAAATTTGGG - Intronic
949015018 2:241703972-241703994 CTGGATTTCTGGGTAAAGTAGGG + Intronic
1169174935 20:3502716-3502738 CTGGACTGCTAGCTATAGTTGGG - Intronic
1169725371 20:8723677-8723699 CTTGACTCATTTGTAAAATTAGG - Intronic
1170296119 20:14828019-14828041 GTGCATTCATTGGTAAAGTTCGG + Intronic
1173086543 20:39924818-39924840 CTGGAATCCTGGAGAAAGTTTGG + Intergenic
1175701360 20:61139932-61139954 CTGGAGACCTAGCTAAAGTTTGG - Intergenic
1181868701 22:25880649-25880671 CTGGACACCTTGATAGAGCTAGG + Intronic
1182181646 22:28355821-28355843 CTGGACTCCATAGTAAAGCAGGG - Intronic
1182539657 22:31031827-31031849 CTGGACATCTTGGTTATGTTAGG + Intergenic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1183807112 22:40220853-40220875 CTGGACTCGTTGGTCTAATTTGG + Intronic
949132021 3:514963-514985 CTGAACTACTTGCTAAATTTGGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950812573 3:15663336-15663358 CTGGCCTCCTTGACCAAGTTAGG + Intergenic
951089460 3:18555539-18555561 CCTGAATCCTTGGTAAAGTTTGG + Intergenic
951784692 3:26404525-26404547 CTGGGCTCCTTGGTATTATTGGG + Intergenic
951906805 3:27714712-27714734 CTTGGCTCCCCGGTAAAGTTCGG + Intergenic
952782355 3:37113869-37113891 GTGTACTCCTAGGAAAAGTTAGG - Intronic
953333490 3:42073883-42073905 CTGAACTCCGGGGTCAAGTTGGG - Intronic
953817335 3:46170213-46170235 CTGCACACCTTGGTAAATTCAGG + Intronic
953951543 3:47194404-47194426 CTGGACTGGTTGCTAAAGATAGG + Intergenic
954586627 3:51742277-51742299 CTGGACTTCTGGGTCAAGTGGGG + Intergenic
960441271 3:117692098-117692120 CTGAAATCCTAGGGAAAGTTTGG - Intergenic
963340995 3:144033514-144033536 CTGGAGTCCTTGATAATGTTTGG + Intronic
964871317 3:161316440-161316462 CTGGCCTTCTTGGAAAAGATGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966209411 3:177437283-177437305 CTGAATTGCTTGGTGAAGTTAGG + Intergenic
967372597 3:188764698-188764720 CCAGACTCCTTGGTAATGCTAGG - Intronic
969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG + Intergenic
969514992 4:7642168-7642190 CTGGCCTCCTTGCCAAGGTTGGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973346441 4:49060524-49060546 CTGGAGTCTGTGGCAAAGTTGGG + Intronic
988675373 5:33427919-33427941 CTGAACTCTTTGGTAAATTCAGG + Intergenic
990016832 5:51073453-51073475 CTGGGGTCCATGGTAAAGTCTGG + Intergenic
990252951 5:53935615-53935637 CTGGATTCCTGGGTAAACCTGGG + Intronic
991995965 5:72386922-72386944 CTTCTCTCCTTGGTAAATTTGGG + Intergenic
993631610 5:90293007-90293029 TTGGACTGATTGATAAAGTTGGG - Intergenic
994957110 5:106546172-106546194 TTGGACTCCTTGGTAACATTTGG + Intergenic
999358026 5:150955436-150955458 CTGGGGTCCATGGCAAAGTTGGG + Intergenic
1000697168 5:164401307-164401329 CTGGATTCTTCGGTAAACTTTGG + Intergenic
1001038593 5:168315808-168315830 CTGAACTCCTAGGTCAAGTCTGG + Intronic
1007027830 6:38595993-38596015 CTTGTCTCCTTGTTGAAGTTGGG - Intronic
1007252684 6:40506743-40506765 CTGGGCTCCTTCTTAAAGTGAGG - Intronic
1010143331 6:72636946-72636968 CTTGACCCCTTGGGAAACTTTGG + Intronic
1016839556 6:148512682-148512704 CTGGACTCCCAGGTAACGGTGGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017412635 6:154185454-154185476 CTGAACTGATTTGTAAAGTTTGG - Intronic
1018958256 6:168427825-168427847 CTGGGCTCCCTGGCACAGTTTGG - Intergenic
1020955945 7:14740127-14740149 CTGGACTCCTTGGCCAAGGGAGG - Intronic
1022189022 7:27998912-27998934 CTGGATAGATTGGTAAAGTTGGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029090028 7:98040770-98040792 CTGTACTCCTTGGGAGAGTGGGG - Intergenic
1031429728 7:121652396-121652418 CTGGTCTCATTGATTAAGTTAGG + Intergenic
1033441684 7:141385871-141385893 CTGGAATCATTTTTAAAGTTAGG - Intronic
1043256696 8:78147710-78147732 CTGGACTTCTTGGTCAGGTGGGG + Intergenic
1043480386 8:80646560-80646582 CTGGTCTTCATGCTAAAGTTGGG + Intronic
1044618028 8:94162412-94162434 CTGTCCTCCTAAGTAAAGTTAGG + Intronic
1045568178 8:103342755-103342777 CTGCACTCCTTGGAAAACTGTGG + Intergenic
1046325149 8:112633297-112633319 CTGGAGACTTTGATAAAGTTGGG - Intronic
1047973034 8:130102601-130102623 CTGGCCTCATTGGAAGAGTTAGG + Intronic
1050026511 9:1340005-1340027 CTGGAGAACTTGGTAAAGCTGGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051272482 9:15368752-15368774 CTGGCCTCCTTGGTAGATTTTGG - Intergenic
1051361840 9:16287811-16287833 GTGGATACCTGGGTAAAGTTAGG + Intergenic
1051870306 9:21729268-21729290 CTGGATACCTTGGTTCAGTTAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053037269 9:34835904-34835926 ATGGACTCCTCGACAAAGTTGGG + Intergenic
1055719227 9:79153135-79153157 TTTGACTCCTTGGCAACGTTGGG + Intergenic
1055802302 9:80051963-80051985 CTGGGGTCCATGGTAAAGTCAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG + Intronic
1189028084 X:37419892-37419914 TTGGTCTCCTTGGTCAAGTCTGG - Intronic
1196108760 X:111923870-111923892 CTGGACACCCTGGTAGAGTACGG - Intronic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic