ID: 1182677921

View in Genome Browser
Species Human (GRCh38)
Location 22:32054586-32054608
Sequence ATGGCCAAAGGCCCTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 526}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182677917_1182677921 -4 Left 1182677917 22:32054567-32054589 CCCAAGTGGAAGGAACAGAATGG 0: 1
1: 0
2: 4
3: 40
4: 350
Right 1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG 0: 1
1: 0
2: 7
3: 76
4: 526
1182677919_1182677921 -5 Left 1182677919 22:32054568-32054590 CCAAGTGGAAGGAACAGAATGGC 0: 1
1: 0
2: 5
3: 33
4: 367
Right 1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG 0: 1
1: 0
2: 7
3: 76
4: 526
1182677913_1182677921 26 Left 1182677913 22:32054537-32054559 CCAGCCATGTGAAGATTCTGGGA 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG 0: 1
1: 0
2: 7
3: 76
4: 526
1182677914_1182677921 22 Left 1182677914 22:32054541-32054563 CCATGTGAAGATTCTGGGATGAG 0: 1
1: 0
2: 1
3: 27
4: 260
Right 1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG 0: 1
1: 0
2: 7
3: 76
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182677921 Original CRISPR ATGGCCAAAGGCCCTGATGT AGG Intronic
900867773 1:5280696-5280718 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
900939158 1:5786744-5786766 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
901183197 1:7355853-7355875 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
901226330 1:7614866-7614888 ATGGGCAAGGGCCCTGATGGAGG - Intronic
901735092 1:11307092-11307114 ATGGCCCAAGTCCCAGAGGTAGG - Intergenic
901785830 1:11623862-11623884 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
902195590 1:14795789-14795811 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
902202398 1:14843597-14843619 ATGGGCAAAGACCCAGAGGTGGG + Intronic
902572409 1:17355194-17355216 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
902619420 1:17642306-17642328 AAGTACAAAGGCCCTGAGGTAGG + Intronic
902738558 1:18418046-18418068 ATGGACAAAGGCCCTGTGGCTGG - Intergenic
902743832 1:18459730-18459752 ATATGCAAAGGCCCTGCTGTAGG - Intergenic
903286337 1:22279332-22279354 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
903349101 1:22707416-22707438 AGAGGCAAAGGCCCTGAGGTGGG - Intergenic
903543401 1:24109106-24109128 GTGGGCAAAGGCCCAGAGGTAGG - Intronic
903662842 1:24989263-24989285 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
903772532 1:25772883-25772905 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
903849267 1:26296501-26296523 ACGGCCCAAGGCCCTGAGGTGGG + Intronic
903926008 1:26831246-26831268 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
903929791 1:26855577-26855599 ATGGCCCAGGGCCCTGAGGCTGG - Exonic
904356401 1:29942871-29942893 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
904377691 1:30092042-30092064 AAGTGCAAAGGCCCTGATGTAGG - Intergenic
904457964 1:30658545-30658567 ATGGGCAAAGGCCCTGTGGCAGG + Intergenic
904484397 1:30815160-30815182 AGGGACAAAGGCCTTGAGGTGGG - Intergenic
904698566 1:32344713-32344735 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
904799931 1:33085460-33085482 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
904888049 1:33756572-33756594 AAGGGCAAAGGCCCTGGGGTGGG + Intronic
904905875 1:33896883-33896905 ACGTGCAAAGGCCCTGAGGTGGG + Intronic
904910325 1:33929802-33929824 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
905558835 1:38909809-38909831 ATGTCCAAAGGCACAGTTGTTGG - Intronic
905634234 1:39538712-39538734 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
905914482 1:41675297-41675319 ATGTACAAAGGCCCTGAGGCAGG - Intronic
906930541 1:50165231-50165253 ATGTGCAAAGGCCCTGAAGCAGG - Intronic
907047291 1:51307033-51307055 ACGTCCAAAGGCCCTGAGGTCGG + Intronic
907052230 1:51337289-51337311 AAGTCCAAAGGGCCTGAGGTGGG - Intronic
907541422 1:55218536-55218558 ATGTGCAAAGGTCCTGTTGTGGG + Intergenic
908153423 1:61328255-61328277 ATGAGCAAAGGCCCTGAGGCAGG - Intronic
909566874 1:77062417-77062439 AAGTGCAAAGGCCCTGAAGTAGG + Intronic
910433852 1:87185286-87185308 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
910459651 1:87435332-87435354 ATTTCCTAAGGCCTTGATGTGGG + Intergenic
910727610 1:90355402-90355424 ATGTCCCAAAGCCCTGAGGTAGG + Intergenic
910803367 1:91166669-91166691 ATGGTTTAAGGCCCTGATGATGG - Intergenic
911230355 1:95354450-95354472 AAGAGCAAAGGCCCTGAGGTAGG - Intergenic
911712078 1:101085223-101085245 ATATACAAAGGCCCTGAGGTGGG + Intergenic
912960342 1:114190350-114190372 ATGGCCAAATGCCCTGCTGCAGG + Intergenic
913066438 1:115260175-115260197 AAGACCAAAGGCTCTGAAGTTGG + Intergenic
913689778 1:121268303-121268325 ATATGCAAAGGCCCTGAGGTGGG + Intronic
913707616 1:121442613-121442635 ATGGGAAAAGGGCCTGAAGTAGG + Intergenic
914147821 1:145011969-145011991 ATATGCAAAGGCCCTGAGGTGGG - Intronic
914706217 1:150172034-150172056 AAGGGCAAAGGTCCTGAGGTGGG - Intergenic
915121765 1:153633873-153633895 GTGGCCAATGGTCCTGTTGTTGG - Intronic
915986624 1:160472316-160472338 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
916504418 1:165415232-165415254 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
916627264 1:166571780-166571802 ATGTGCAAAGGCCTTGAGGTAGG + Intergenic
919658630 1:200221775-200221797 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
920477099 1:206286780-206286802 ATATGCAAAGGCCCTGAGGTGGG + Intronic
921058125 1:211559939-211559961 AGGGGCAAAGGCCCTGGAGTGGG - Intergenic
922204129 1:223431894-223431916 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
1063437772 10:6048453-6048475 ATGGCCAAAGGCCCTTCCCTCGG - Intronic
1065915929 10:30355026-30355048 ATGTGCAAAGGTCCTGAAGTAGG + Intronic
1065982441 10:30913377-30913399 ATGGGCAAAGACCCTGTGGTGGG - Intronic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1067231878 10:44417857-44417879 TTGTGCAAAGGCCCTGAGGTAGG + Intergenic
1067402819 10:45992955-45992977 AAGAACAAAGGCCCTGAAGTGGG - Intronic
1067509786 10:46885215-46885237 ATGAACAAAGGCCCTGAGATGGG + Intergenic
1067652468 10:48166643-48166665 ATGAACAAAGGCCCTGAGATGGG - Intronic
1068397181 10:56478581-56478603 ATGGCCAAAGGGCTTCATGTTGG - Intergenic
1068886019 10:62097920-62097942 ATGTGCAAAGGCCCTGAAGCAGG + Intergenic
1069717640 10:70531202-70531224 TTGGGCAGAGGCCCTGAGGTGGG + Intronic
1070432465 10:76354604-76354626 AAGGCCCATGGCCCTGATTTAGG + Intronic
1070588937 10:77787862-77787884 GTGGCCACGGGCCCTGATGGTGG + Intergenic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1070719648 10:78747176-78747198 ATGAGCAAAGGCCCTGGGGTGGG - Intergenic
1070941812 10:80355150-80355172 ATGAGGAAAGGCCCTGATATAGG + Intronic
1071890972 10:90006705-90006727 ATGTGCAAATGCCCTGAGGTGGG + Intergenic
1072207282 10:93215541-93215563 ATGGCCGCTGGCCCTGATGGAGG - Intergenic
1072737857 10:97891337-97891359 TTGGCCAAAGGCCCAGAAGTGGG - Intronic
1072740694 10:97907390-97907412 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1074600600 10:114909503-114909525 ATGTGCAAAGGCCCTGTGGTGGG - Intergenic
1074718538 10:116243777-116243799 ATGGCCACAGGCCCTGGTCAAGG + Intronic
1075114398 10:119613764-119613786 AAGGGCAAAGGCCCTGGGGTGGG - Intergenic
1075600574 10:123765669-123765691 ATGCCCAAGGGTGCTGATGTGGG - Intronic
1076378855 10:130011432-130011454 ATGGGCAAAGACCCTGAGGGTGG + Intergenic
1076488995 10:130843933-130843955 ATTGCCAAAGCCATTGATGTGGG + Intergenic
1077797343 11:5506425-5506447 ATGTACAAAGGCACTGAGGTAGG - Intronic
1078087256 11:8241552-8241574 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1078458802 11:11497072-11497094 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1079130018 11:17741804-17741826 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1079299370 11:19263950-19263972 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1079341820 11:19617880-19617902 AAGTGCAAAGGCCCTGAAGTGGG - Intronic
1081266021 11:41022540-41022562 ATGACCTAACACCCTGATGTAGG - Intronic
1081280597 11:41205080-41205102 ATATCCAAAGGCCCTGAGGTGGG + Intronic
1081976873 11:47240997-47241019 AGGGCAAAAGGCCCAGATGTGGG + Intronic
1083320093 11:61840497-61840519 AAGGACAAAGGCCGTGATGAGGG - Exonic
1083538718 11:63495692-63495714 ATGGCTAAGGGCCTGGATGTGGG - Intergenic
1084430535 11:69108311-69108333 CTGGACAAAGGCCCTGAGGCTGG - Intergenic
1085345527 11:75765973-75765995 ATGGACAAAGGCCTGGAGGTAGG - Intronic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085519730 11:77130919-77130941 ATGTGCAAAGGCCCAGGTGTGGG + Intronic
1088412654 11:109552399-109552421 ATGTACAAATGCCCTGATGTGGG + Intergenic
1088706525 11:112468884-112468906 ATGTGCAAAGACCCTGAGGTGGG - Intergenic
1088798037 11:113281180-113281202 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1089109728 11:116045751-116045773 ATGTGCAAAGGCCCTGTGGTAGG - Intergenic
1089343022 11:117772463-117772485 ATGGACAAAGGAGCTGATGCAGG + Intronic
1091789379 12:3262941-3262963 ATGGTCAAAGGCCCTGGTTAAGG - Intronic
1091874067 12:3919137-3919159 ATGGCCAAAGGCACAGAAGTTGG - Intergenic
1091906045 12:4189835-4189857 AGGGGCAAAGGCCCTGAGATGGG + Intergenic
1091907829 12:4203137-4203159 ATGCACAAAGGCCCTGAGGCAGG - Intergenic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1091979274 12:4852651-4852673 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092762228 12:11820586-11820608 AAGTCCAAAGGCCCTGAGGTGGG + Intronic
1092896039 12:13011283-13011305 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092994397 12:13934650-13934672 ATGGCCAGATGCCCTGTTATGGG - Intronic
1093959893 12:25260672-25260694 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
1095926380 12:47583718-47583740 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1098134900 12:67391842-67391864 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1098249973 12:68559444-68559466 AAGGACAAAGGCCCTGAGGTAGG + Intergenic
1100959354 12:99945303-99945325 AGGTGCAAAGGCCCTGAAGTAGG + Intronic
1100966779 12:100021818-100021840 TTAGCAAAAGGCCATGATGTAGG - Intergenic
1101008598 12:100426942-100426964 AAGGGCAAAGGCCCTGAAGGGGG + Intergenic
1101115745 12:101529702-101529724 ATTTACAAAGGCCCTGAGGTGGG - Intergenic
1101680984 12:106965173-106965195 AAGAGCAAAGGCCCTGATGTGGG - Intronic
1101733200 12:107443506-107443528 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1101815793 12:108145152-108145174 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1102173504 12:110859871-110859893 ATAAGCAAAGGCCCTGAGGTGGG - Intronic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102207297 12:111099240-111099262 CTGGCCAAAGGCTCGGAGGTGGG + Intronic
1102380927 12:112466311-112466333 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
1102383482 12:112486807-112486829 ATGGCCAATGGCAGTGCTGTAGG - Intronic
1102400831 12:112628267-112628289 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
1102452592 12:113052993-113053015 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
1102462164 12:113106546-113106568 ATGTGCAAGGGCCCTGAGGTAGG - Intronic
1102465598 12:113129329-113129351 ATGGGCAAAGGCCCTGTAGCAGG + Intronic
1102477456 12:113197880-113197902 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1102527682 12:113523684-113523706 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102648358 12:114418536-114418558 ATGTGCAAAGGCCCTGGGGTAGG - Intergenic
1102806160 12:115782683-115782705 TTGGACAAAGGCCCTTATGCCGG - Intergenic
1102929033 12:116848631-116848653 ATGTGCAAAGGCCCTGAGGCTGG - Intronic
1103002198 12:117393691-117393713 ATATGCAAAGGCCCTGAGGTTGG + Intronic
1103041818 12:117702096-117702118 ATGTGCAAAGGCCCTGGAGTGGG - Intronic
1103042995 12:117711359-117711381 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1103043532 12:117715922-117715944 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103570016 12:121838823-121838845 ACGGAGAAAGGCCCTGAGGTGGG - Intergenic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1103860703 12:124010895-124010917 ATGTACAAAGGCCCTGAGGCAGG + Intronic
1103938666 12:124490097-124490119 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1104047022 12:125170676-125170698 GAGTGCAAAGGCCCTGATGTGGG + Intergenic
1104085803 12:125473173-125473195 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1104377735 12:128279617-128279639 ATGTGCAAAGGCCCTGCGGTGGG - Intronic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104475333 12:129066419-129066441 ATGGGCAAAGGCCTTGAGGTGGG + Intergenic
1104822656 12:131687228-131687250 ACGCCCAAAGGCCCTGCAGTCGG + Intergenic
1104887639 12:132120003-132120025 ATGGCCATAGGGCCTGGTGGGGG - Intronic
1105211216 13:18258240-18258262 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1105781406 13:23707902-23707924 ATGTCCAAAGGCCCTGAGGTGGG - Intergenic
1106029886 13:25990503-25990525 ATATGCAAAGGCCCTGAGGTGGG + Intronic
1106258281 13:28041287-28041309 ATGGCCAAAGACCCTGAAAAAGG + Intronic
1106278677 13:28241832-28241854 ATGGCAAAAGCCCCAGATATTGG + Intronic
1107114094 13:36727850-36727872 GTGGCCAAAGGCCCTAAGGCAGG - Intergenic
1108495974 13:51025793-51025815 ATGGCAAATGTCCCTGATGCTGG - Intergenic
1110356589 13:74574569-74574591 ATGAACAAAGGCACTGAGGTAGG - Intergenic
1114575847 14:23712644-23712666 ATGGCCAACGGATCTGATTTAGG + Intergenic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1116638504 14:47429983-47430005 ATGTGCAAAGTCCCTGAGGTGGG + Intronic
1117956498 14:61127492-61127514 ATCCCCAAAGGCACTGATGGAGG - Intergenic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118480458 14:66159675-66159697 ATGTGCAAAGGCCCTGGGGTTGG + Intergenic
1119095132 14:71823086-71823108 ATGGACAAAGACCCTAAAGTGGG - Intergenic
1119517780 14:75261772-75261794 ATGGTCATGGGCCATGATGTGGG + Intronic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119644241 14:76337053-76337075 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1119895219 14:78214231-78214253 ATGGACAAAGGCCCTGTGGTAGG - Intergenic
1119946301 14:78698441-78698463 ATGGCCAAAGGCCTCATTGTTGG + Intronic
1119970876 14:78968818-78968840 ATGTCCAAATGCCATGATGATGG + Intronic
1121883972 14:97525774-97525796 ATGTGCAGAGGCCCTGGTGTGGG + Intergenic
1122580535 14:102768991-102769013 CTGGCCAGAGGCCCTGAAATTGG - Intergenic
1123758689 15:23416509-23416531 ATGAGCAAAGGCCATGAAGTGGG + Intergenic
1124651588 15:31478033-31478055 ATGTGCAAAGGCCCTGAGGCAGG + Exonic
1127146290 15:56027504-56027526 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1128090650 15:64916685-64916707 ATGGGCAGAAGCCCTGAGGTAGG + Intronic
1128255848 15:66196036-66196058 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1128317574 15:66670952-66670974 AAGGGCAAAGGCCCTGAGGTGGG + Intronic
1128360114 15:66956086-66956108 ATGGGCAAAGGCCCGGGGGTGGG - Intergenic
1128614404 15:69098209-69098231 ATGTACAAAGGCCCTGAGGCTGG + Intergenic
1128831428 15:70772756-70772778 AGGGCCAAGGGCCTAGATGTGGG + Intergenic
1129264137 15:74384950-74384972 AGGGCCATAGGCCCTGAGATTGG - Intergenic
1129479413 15:75811122-75811144 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1129556532 15:76516074-76516096 ATTGACAAAGGCCCTGTGGTTGG - Intronic
1129664519 15:77572098-77572120 ATGGCCAGAGACCCTGTTGGTGG + Intergenic
1129774690 15:78228799-78228821 ATGTGCAAAGGCCCCGAGGTGGG - Intronic
1129998047 15:80023752-80023774 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1131380697 15:91961599-91961621 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1131844218 15:96471640-96471662 AGGTCCAAAGGCCCTGGGGTAGG - Intergenic
1131931931 15:97452298-97452320 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1132666155 16:1082186-1082208 ATGACCAAAGGCACAGATGTGGG - Intergenic
1132873861 16:2127342-2127364 ATGGGCAAACACCCAGATGTAGG + Intronic
1133467928 16:6045897-6045919 CAGGGCAAAGGCCCTGAAGTAGG + Intronic
1133540758 16:6751020-6751042 ATGTTCAAGGGCCCTGATGTGGG + Intronic
1133912373 16:10077748-10077770 ATATGCAAAGGCCCTGAGGTGGG - Intronic
1133928961 16:10216682-10216704 ATGTGCAAAGGCCCTGAGGAGGG + Intergenic
1134457645 16:14406352-14406374 ATGGGCAAAGGCCATGAAGTGGG - Intergenic
1134505814 16:14806011-14806033 ATGTGCAAAGGCCCAGAGGTGGG - Intronic
1134574766 16:15322928-15322950 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134801200 16:17086219-17086241 ATGAGCAAAGGCCCTAGTGTGGG - Intergenic
1134865702 16:17604931-17604953 ATGGGCAAAGGCCCTGGAGTCGG - Intergenic
1134939758 16:18278289-18278311 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1135470785 16:22728705-22728727 CTGGTCACAGGCCCTGATGTGGG + Intergenic
1135535941 16:23294569-23294591 AAGGGCAAAGGCCCTGCAGTGGG - Intronic
1135640403 16:24115035-24115057 ATGTGCAAAGGCCCTGTGGTTGG + Intronic
1135814710 16:25621965-25621987 ATGTGCAAAGGCCCAGATGCAGG - Intergenic
1135828892 16:25755423-25755445 ATGCCCAAAGACCCAGATTTTGG + Intronic
1136017101 16:27407487-27407509 ATGTCCAAAGGCCCTGATGCAGG + Intronic
1136088975 16:27904706-27904728 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1136412989 16:30087694-30087716 ACGTGCAAAGGCCCTGAGGTGGG - Intronic
1136511673 16:30741688-30741710 AAGGCCAAGGGCTCTGTTGTTGG + Intronic
1137759695 16:50930453-50930475 ATTTCCAAAGGCCCTGAAATAGG + Intergenic
1137804312 16:51288930-51288952 AGGTGCAAAGGCCCTGAAGTGGG - Intergenic
1138335347 16:56248723-56248745 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138512973 16:57519215-57519237 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1138604301 16:58078021-58078043 ACGGCCAGAGGCCCTGAGGCAGG + Intergenic
1138710071 16:58961242-58961264 ATGCGCGAAGGCCCTGAGGTAGG + Intergenic
1139416427 16:66814944-66814966 ATGTGCAAAGGCCCAGAAGTGGG - Intronic
1140636450 16:76920536-76920558 ATGTGCAAAGGCCCTAATGCAGG + Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1143230943 17:5354195-5354217 ATGGCCAGAGGCCCTTAGATGGG + Intronic
1143327161 17:6106887-6106909 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1143458498 17:7083686-7083708 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1143731140 17:8883534-8883556 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1143736760 17:8916539-8916561 ATGGGGGAAGGCCCTGTTGTTGG - Intronic
1144517134 17:15926513-15926535 ATGTCCAAAGGCCCTGTGGCAGG + Intergenic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145239579 17:21232545-21232567 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1145253161 17:21307485-21307507 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145323410 17:21780433-21780455 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1146423801 17:32716153-32716175 ATGTGCAAAGACCCTGAAGTAGG - Intronic
1147444185 17:40464752-40464774 ACGTGCAAAGGCCCTGAGGTTGG - Intergenic
1148194891 17:45706231-45706253 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1149419991 17:56501115-56501137 ACAGCAAAAGGCCCTGAGGTAGG + Intronic
1151541061 17:74764713-74764735 CTGGCCAAAGGACCTGAAGAGGG + Intronic
1151686203 17:75648154-75648176 ATGTGCAAAGGCCCTGTGGTGGG - Intronic
1154349171 18:13568696-13568718 AAGGCCACAGGTCCTGATGTGGG - Intronic
1155505588 18:26529453-26529475 ATGAGCAAAGGCCCTGATACAGG - Intronic
1155514788 18:26613827-26613849 ATGTGCAAAGGCCCCGATATAGG - Intronic
1155887654 18:31227636-31227658 AAAGCCAAAGGGCCTGAGGTTGG - Intergenic
1156218889 18:35030899-35030921 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1156779683 18:40836489-40836511 TTGGCAAAAGGCTCTGATGCAGG + Intergenic
1157235696 18:45963336-45963358 ATGGGCAAAGGCCCTGAAGCAGG + Intronic
1158403427 18:57140952-57140974 CTGGCCAATGGCCCTGCAGTTGG + Intergenic
1158477173 18:57790537-57790559 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1158925459 18:62253217-62253239 AAGAACAAAGGCCCTGAGGTGGG + Intronic
1161098741 19:2409711-2409733 ATGTGCAAAGGCCCTGGGGTGGG + Intronic
1161273379 19:3402793-3402815 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1161585135 19:5101805-5101827 AGACCCAAAGGGCCTGATGTGGG - Intronic
1161869124 19:6856952-6856974 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1161874138 19:6894522-6894544 ATGTGCAAAGGCCCTGTGGTAGG + Intronic
1161877745 19:6924963-6924985 ATATGCAAAGGCCCTGAGGTAGG - Intronic
1162064912 19:8119434-8119456 ATGTGCAAAGGCCCTGGGGTGGG - Intronic
1162152903 19:8658095-8658117 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162418154 19:10550639-10550661 AAGCGCAAAGGCCCTGAGGTGGG - Intronic
1162442175 19:10699725-10699747 AGGTGCAAAGGCCCTGAGGTTGG + Intergenic
1162466783 19:10846968-10846990 GTGTGCAAAGGCCCTGAGGTTGG + Intronic
1162554782 19:11380048-11380070 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1163113490 19:15175794-15175816 TTGTGCAAAGGCCCTGATATGGG + Intronic
1163205838 19:15802133-15802155 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1163253099 19:16138432-16138454 ACGGGCAAAGGCCCTGTGGTAGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163549470 19:17957572-17957594 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
1163627957 19:18401681-18401703 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1163630675 19:18416695-18416717 AAGGGCCAAGGCCCTGAGGTGGG - Intergenic
1163631875 19:18421660-18421682 AAGTGCAAAGGCCCTGATATGGG + Intronic
1163695397 19:18761075-18761097 ATGTGCAGAGGCCCTGAGGTGGG - Intronic
1163702521 19:18793298-18793320 ATAGGCAAAGGCCCTGAGGCAGG + Intergenic
1163703512 19:18798999-18799021 AGGGGCAAAGGCCCAGAGGTGGG + Intergenic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1163731448 19:18951894-18951916 ACGCCCAAAGGCCCTGAGGCAGG + Intergenic
1163766347 19:19165485-19165507 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1163849880 19:19656789-19656811 TTGGCCAGAGGCCCTGAGGCTGG + Intronic
1164514329 19:28921369-28921391 AAGGGCAAAGGCCCTGGGGTGGG + Intergenic
1164553604 19:29232920-29232942 ATGTTCAAAGGCCCTCATATGGG + Intergenic
1164678106 19:30115871-30115893 ATGTGCAAAGGCCTTGAAGTGGG + Intergenic
1164700117 19:30279042-30279064 AAGTGCAAAGGCCCTGAGGTTGG - Intronic
1164892788 19:31839395-31839417 ATGTGCAAAGGCCCTGAGGCTGG + Intergenic
1165042928 19:33081656-33081678 AGTGGCAAAGGCCCTGAAGTGGG + Intronic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165784636 19:38453736-38453758 ATGTGCAAAGGCCATGAGGTGGG + Intronic
1165950587 19:39472222-39472244 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1166321031 19:42019015-42019037 AGGGCCAAAGGCTCCGATGAGGG + Intronic
1166500390 19:43336708-43336730 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1166509788 19:43397303-43397325 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1166650501 19:44570756-44570778 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1166929187 19:46291098-46291120 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1167277855 19:48549842-48549864 AAGGGCAAAGGCCCTGCAGTAGG + Intergenic
1167284029 19:48588825-48588847 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1167347790 19:48957098-48957120 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
928535521 2:32236480-32236502 ATTTCCAAAGGCTCTGGTGTAGG + Intronic
929686595 2:44040354-44040376 ATGGCAAAAGGCACAGTTGTGGG + Intergenic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
930065422 2:47324080-47324102 ATGCTCAAAGGCTCTGAGGTGGG + Intergenic
930866176 2:56124036-56124058 CTTTCCAAAGGCCCTGTTGTGGG + Intergenic
931982828 2:67712554-67712576 ATGGCAAAAGGCCCCGAGCTGGG - Intergenic
932083781 2:68739305-68739327 ATGCCCAATGGCCCTGGCGTGGG + Intronic
932457530 2:71858795-71858817 AGTGACAAAGGCCCTGATGCAGG - Intergenic
937478152 2:122233518-122233540 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
938768540 2:134480266-134480288 ATGTGCAAAGGCCCTGGGGTAGG - Intronic
942665330 2:178311221-178311243 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
942977362 2:182034426-182034448 ATGTACAAAAGCCCTGAGGTGGG + Intronic
944605624 2:201349268-201349290 AAGTCCAAAGGCCCTGGGGTGGG - Intronic
944917652 2:204377656-204377678 AAGGGCAAAGGGCCCGATGTTGG + Intergenic
945324133 2:208463265-208463287 ACAGGCAAAGGCCCTGAGGTGGG - Intronic
946146583 2:217735581-217735603 AGGAGCAAAGGCCCTGAGGTGGG - Intronic
946235159 2:218319973-218319995 ATAGGCAAAGGCCCTGAGGTGGG + Intronic
946439222 2:219680884-219680906 ATTGCCAATGACCCAGATGTTGG - Intergenic
946866670 2:224046994-224047016 ATGGCCCATTGCCCTGAGGTTGG - Intergenic
946960459 2:224979598-224979620 AAGGCGAAAGGCCCTAATGTGGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947566921 2:231200184-231200206 ATGCGCAAAGGCCTTGAGGTTGG + Intronic
947929563 2:233952493-233952515 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
947933693 2:233985165-233985187 ATGGGCAAAGGCCCCGTGGTGGG - Intronic
948316644 2:237032273-237032295 ATGTGCAAAGGCCCTGAGCTGGG - Intergenic
1168742294 20:202078-202100 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1168787268 20:550783-550805 ATGGGCAAAGACCGTGAAGTAGG + Intergenic
1168832347 20:853510-853532 ATGTGCAAAGGCCCTGTGGTGGG + Intronic
1168832405 20:853791-853813 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168889406 20:1284693-1284715 ATGTGCAGAGGCCCTGATGAGGG + Intronic
1168908158 20:1423349-1423371 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1168923175 20:1557953-1557975 ATAGGCAAAGGCCATGAAGTTGG - Exonic
1168951440 20:1804679-1804701 AAGGGCAAAGGCCTTGAGGTGGG + Intergenic
1168952771 20:1813849-1813871 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
1168978289 20:1984198-1984220 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1170564889 20:17593660-17593682 ATGAGCAAAGGCCCTGAAGTGGG + Intronic
1170580335 20:17694396-17694418 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1171199188 20:23227462-23227484 CTGGCCCAAAGCCCTGATGAGGG + Intergenic
1171244690 20:23601963-23601985 AAGGTCAGAGGCCCTGAAGTTGG + Intergenic
1171987764 20:31672500-31672522 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1172189708 20:33054575-33054597 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1172190027 20:33056350-33056372 GTGGCCACAGGCCCTGCGGTGGG + Intronic
1172700587 20:36851510-36851532 AAGGCCAAAGGCTTTGAGGTGGG - Intronic
1172957158 20:38769140-38769162 ATGTACAAAGGCCCTGAGGCAGG - Intronic
1173178144 20:40780777-40780799 AAGTCCAAAGGCCCTGAGGCCGG + Intergenic
1173802907 20:45905983-45906005 ATGAGCAAAGGCCCTGAGGTGGG + Intronic
1173850369 20:46214125-46214147 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1173919084 20:46730561-46730583 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1173968136 20:47129461-47129483 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174170652 20:48616220-48616242 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1174180478 20:48671275-48671297 ATGGCCAAAGGCTGTCCTGTTGG - Intronic
1174189645 20:48731165-48731187 GTGTGCAAAGGCCCTGAGGTAGG - Intronic
1174200668 20:48804484-48804506 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174302920 20:49595160-49595182 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1174385370 20:50185653-50185675 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1174428284 20:50448844-50448866 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1174699207 20:52590665-52590687 AGGGCCAAAGGCCTTGAGGTGGG - Intergenic
1174887186 20:54348785-54348807 AAGGTCAAAGACCCTGAGGTAGG + Intergenic
1175040040 20:56040349-56040371 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175320709 20:58086011-58086033 ATGGCCAACTGGCCTGCTGTAGG + Intergenic
1175553661 20:59832768-59832790 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1176893928 21:14352726-14352748 ATGTCCAAATGCTCTGATGGTGG - Intergenic
1177861343 21:26458176-26458198 ATGTGCAAAGGCCCTGAGTTTGG + Intergenic
1177975076 21:27838186-27838208 ATTGCCAAAACCACTGATGTCGG - Intergenic
1179165184 21:38929956-38929978 ATGGACTAAGGCACTGATGAAGG + Intergenic
1179437964 21:41375034-41375056 ATGTGCAAAGGTCCTGAGGTCGG - Intronic
1180765020 22:18341197-18341219 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1180814009 22:18778487-18778509 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1181200194 22:21212822-21212844 ATGTGCAAAGGACCTGAGGTAGG + Intronic
1181689452 22:24550395-24550417 ATGTGCTAAGGCCCTGAGGTGGG + Intronic
1181701543 22:24624137-24624159 ATGTGCAAAGGACCTGAGGTAGG - Intronic
1181756074 22:25025974-25025996 AAGGCCAATGGCCCTGATTCTGG + Intronic
1181911685 22:26243468-26243490 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1181962184 22:26630174-26630196 ATGATCAAAGGCCCTGTGGTAGG + Intronic
1181971724 22:26695670-26695692 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
1181972067 22:26698370-26698392 ATGTGCAAAGGCCCTGTGGTAGG - Intergenic
1182012391 22:27011738-27011760 ATGTTCAAAGGCCCTGAGGCAGG - Intergenic
1182077275 22:27503638-27503660 ATGGGCAAAGGCCCTGAGAGAGG + Intergenic
1182093922 22:27613818-27613840 ATGTGCAAAGGCCCTGTGGTGGG - Intergenic
1182362648 22:29756066-29756088 CTGGCCAAAGGCCGAGCTGTTGG - Intronic
1182465831 22:30515582-30515604 ATGTCCAAAGGCCTTGTGGTAGG - Intergenic
1182541950 22:31048163-31048185 ATGGGCAAAGGCCCTGAAGCAGG - Intergenic
1182677921 22:32054586-32054608 ATGGCCAAAGGCCCTGATGTAGG + Intronic
1183384105 22:37505117-37505139 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1183559529 22:38560285-38560307 AAGTGCAAAGGCCCTGATGCAGG + Intronic
1184088049 22:42277542-42277564 ATGGGCAAAGGCCCTGCGGTAGG + Intronic
1184098736 22:42330390-42330412 GTGTACAAAGGCCCTGAGGTGGG - Intronic
1184099085 22:42332277-42332299 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1184104589 22:42360079-42360101 GTGGGCAAAGGCCCCGAGGTGGG - Intergenic
1184406248 22:44302617-44302639 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406262 22:44302657-44302679 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406276 22:44302697-44302719 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406290 22:44302737-44302759 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406304 22:44302777-44302799 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406318 22:44302817-44302839 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406332 22:44302857-44302879 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406346 22:44302897-44302919 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184421761 22:44386309-44386331 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1203226643 22_KI270731v1_random:82102-82124 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1203264108 22_KI270734v1_random:4174-4196 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
949337134 3:2987132-2987154 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
949367715 3:3301184-3301206 ACGGTCAAAGGCTCTGAGGTAGG - Intergenic
949399616 3:3652178-3652200 ATGGGTAAAAGCCCTGATGTAGG - Intergenic
949879467 3:8650031-8650053 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
950181869 3:10919040-10919062 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
950566194 3:13771074-13771096 AGGGGCAAAGGCCCTGAGGCAGG - Intergenic
950701985 3:14757270-14757292 CTGGTCAAAGGCCCTGCTGCAGG - Intronic
950774267 3:15336212-15336234 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
951188940 3:19746995-19747017 ATGTACAAAGGTCCTGAGGTGGG + Intergenic
951844591 3:27071904-27071926 AAGTCCAAAGGCCCTGAGGCAGG - Intergenic
951854614 3:27181032-27181054 ATGACCAAAGATCCTGAGGTAGG - Intronic
952145666 3:30529300-30529322 ATGTGCAAAGGCACTGAAGTGGG - Intergenic
952252844 3:31671384-31671406 ATGTGCAAAGGCCCTGGGGTAGG + Intronic
952794858 3:37229897-37229919 ATGGCCAAAGTCCCTGTACTGGG + Intergenic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
953718435 3:45335340-45335362 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
953927634 3:46990476-46990498 ATGGGCTAAGACCCTGAGGTGGG - Intronic
955101640 3:55855460-55855482 TTGGCCAAAGGCCTGGATTTGGG - Intronic
955857367 3:63287576-63287598 ATTGCCGATGTCCCTGATGTTGG - Intronic
955969641 3:64425471-64425493 AAGGGCAAATGCCCTGAGGTAGG + Intronic
957631914 3:82727085-82727107 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
960203043 3:114861058-114861080 AGGTCTAAAGGCCCTGAGGTGGG - Intronic
960300497 3:115997604-115997626 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
961156800 3:124686527-124686549 ATGAACAAAAGCCCTGAGGTGGG + Intronic
961365676 3:126397941-126397963 AGGCCCAAAGGCCCTGAGGTGGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
961801917 3:129457464-129457486 ATGTGCAAAGGCCCTGAAGCAGG - Intronic
962079689 3:132124633-132124655 ATAGGCAAAGTCCCTGAGGTGGG + Intronic
962396020 3:135015897-135015919 CAGGACAAAGGCCCTGAGGTGGG + Intronic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
962647083 3:137451038-137451060 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
963645680 3:147911266-147911288 ATGTGCAAAGGTCCTGAGGTGGG - Intergenic
964721078 3:159767648-159767670 AAGGGCAAAAGCCCTGAAGTAGG - Intronic
965485850 3:169277572-169277594 ATGTCCAAAGTCCCTGGTATAGG - Intronic
965688354 3:171328943-171328965 AAGTACAAAGGCCCTGAGGTGGG - Intronic
966805905 3:183807287-183807309 CTGCCCAAGGGCTCTGATGTGGG - Intronic
967907033 3:194509963-194509985 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
968292877 3:197552579-197552601 AAGGACAAAGGCCCTGAAGCAGG - Intronic
968808469 4:2789530-2789552 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
969317795 4:6392558-6392580 ACGAGCAAAGGCCCTGAGGTAGG + Intronic
969454043 4:7291096-7291118 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
969527766 4:7712723-7712745 GTGGCCAAAGACCCTGGGGTGGG - Exonic
969912741 4:10460546-10460568 ATGTACAAAGGCCCTGAGGTGGG + Intergenic
970561496 4:17285918-17285940 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
970811436 4:20099114-20099136 ATGTCCAAAGGGCCTGAGCTGGG + Intergenic
971423094 4:26491638-26491660 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
972294463 4:37723271-37723293 ATGTTCAAAGGCCCTGTGGTAGG - Intergenic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
973794049 4:54405875-54405897 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
974033785 4:56799554-56799576 CTGGCTAAAGCTCCTGATGTGGG - Intergenic
974433280 4:61826287-61826309 GTGTTCAAAGGCCCTGAAGTAGG + Intronic
975180599 4:71339605-71339627 ATGGCCAATGGGCATGATGTTGG + Intronic
976269197 4:83213787-83213809 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
976894918 4:90097627-90097649 AAGGACAAATGCCCTGATGCAGG + Intergenic
977007440 4:91587263-91587285 ATGTTGAAAGGTCCTGATGTTGG - Intronic
977645744 4:99409860-99409882 ATGGCCAAAGGCCATTAATTTGG - Intergenic
977883874 4:102236390-102236412 TTTGCCCAAAGCCCTGATGTAGG + Intergenic
978788959 4:112640923-112640945 AAGGGCAAAGGCCCTGAAGTGGG + Intronic
980108054 4:128607425-128607447 ATGGGCAAAGGCTCTGTGGTAGG + Intergenic
985901279 5:2796660-2796682 ATGGCCAAGTGTCATGATGTGGG - Intergenic
986351650 5:6885661-6885683 CTGTGCAAAGGCCCTGATGGGGG + Intergenic
986805543 5:11305371-11305393 ATGACCAAAGGCACTGGAGTGGG - Intronic
987039892 5:14052574-14052596 AAGGGCAAAGGCCCTGAGGCGGG + Intergenic
987568736 5:19627784-19627806 ATGCACAAATGCCCTAATGTGGG + Intronic
988399351 5:30741840-30741862 ATGTGCAAAGGCCCTGGTATAGG - Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
989268254 5:39502636-39502658 ATTCCCAAAGGTCCTGATTTAGG - Intergenic
990599653 5:57344881-57344903 ATGTGCAAAGGCCCTGAAGCAGG - Intergenic
991499929 5:67267132-67267154 ATGTGCAAAGGCCCGGATGAGGG + Intergenic
992066852 5:73117286-73117308 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
995112689 5:108445295-108445317 ATGGGCAAAGGCCCTGAAGTAGG + Intergenic
995913241 5:117212940-117212962 CTGACTAAAGGCCCTGTTGTAGG - Intergenic
997295923 5:132768343-132768365 ATGGCCACTGGCCCTGATGGAGG + Intronic
997420827 5:133765530-133765552 AGGGGCACAGGCCCTGATGTTGG - Intergenic
997677680 5:135725428-135725450 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
997791719 5:136767986-136768008 AGGTGCAAAGGCCCTGAGGTAGG + Intergenic
998418200 5:141960436-141960458 ATGGGCAAAGGCCCCGAAGTGGG + Intronic
998447088 5:142206653-142206675 ATGGCCATAGGTCCTGTTGGGGG - Intergenic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
999105326 5:149065494-149065516 AGGAGCAAAGGCCCTGAAGTAGG + Intergenic
999294863 5:150452885-150452907 ATATGCAAAGGCCCTGAAGTGGG + Intergenic
999307021 5:150526082-150526104 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
999591903 5:153157495-153157517 AAGGTCAAAGGCCCTGAGCTCGG + Intergenic
999873877 5:155781279-155781301 ATCCCCAAAGGACCTGAAGTCGG - Intergenic
1000036062 5:157448894-157448916 TAGGCCAAAGGCCCTGAGGTGGG - Intronic
1000192517 5:158925060-158925082 ATGTGCAAAGGCCCTGAGATTGG - Intronic
1001092591 5:168752265-168752287 ATGTCCAAGGGCCCTGTGGTTGG - Intronic
1001099829 5:168804943-168804965 ATGTGCAAAGGCCCTGACGCTGG - Intronic
1001197005 5:169682369-169682391 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1001286061 5:170424943-170424965 ATGTGCAAAGGCCCTTAGGTAGG - Intronic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001677548 5:173531160-173531182 ATGTTCAAAGGCCCTGAGGTGGG + Intergenic
1002061303 5:176627526-176627548 AAGGCCAGAGGGCCTGATCTGGG + Intronic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1002772345 6:300779-300801 ACAGCCAAGGACCCTGATGTGGG - Intronic
1003853590 6:10250248-10250270 AAGTGCAAAGGCCCTGATGTTGG - Intergenic
1004464479 6:15871680-15871702 TTGGGCAAAGGCCTTGATGTTGG - Intergenic
1004700959 6:18079066-18079088 AAGGGCAAAGGCCCTGAGCTGGG + Intergenic
1004882869 6:20025889-20025911 ATGTGCAAAGGCCCTGGGGTAGG - Intergenic
1005008694 6:21314899-21314921 ATGGCAAATGAACCTGATGTGGG - Intergenic
1006430847 6:33994870-33994892 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1006430934 6:33995269-33995291 ATGGCCAAAGGCGCTGCAGAGGG + Intergenic
1006457479 6:34140234-34140256 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1006809974 6:36813727-36813749 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006835521 6:36996734-36996756 AAGAGCAAAGGCCCTGAGGTGGG + Intergenic
1006929405 6:37678651-37678673 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007760139 6:44128402-44128424 TGGGGCAAAGGCCCTGTTGTGGG + Intronic
1007768174 6:44173403-44173425 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1008348019 6:50453473-50453495 CTTGGCAAAGGCCCTGAGGTAGG - Intergenic
1008587242 6:52960965-52960987 ATTGCCCAAAGCCCTGTTGTAGG - Intergenic
1011471765 6:87715265-87715287 ATGGTCAAGGGCACTGATTTTGG - Intergenic
1011863162 6:91786180-91786202 ATGGACAAAGGCCCTGCAGCAGG + Intergenic
1012727740 6:102837688-102837710 TTGGCTAATGGCCCTAATGTTGG - Intergenic
1012764703 6:103352115-103352137 ATGTTCAAAGACCCTGAAGTGGG - Intergenic
1013191298 6:107806326-107806348 ATGTCCAAAGGGCCAGAAGTGGG - Intronic
1017043411 6:150325578-150325600 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1017534329 6:155330350-155330372 ATGTGCAAAGGCCCTGGTGTAGG + Intergenic
1018276064 6:162132904-162132926 ATGTACAAAGGTCCTGATGCAGG + Intronic
1019824877 7:3275736-3275758 AAGTCCAAAGGCCCTGAAGCAGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1021411855 7:20337945-20337967 ATGGCCAAGGACACTGATGCAGG + Intronic
1021766556 7:23955772-23955794 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1021803603 7:24332935-24332957 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1022378335 7:29835951-29835973 ATGACCACAGGCCCTGGTGAGGG + Intronic
1022690764 7:32650531-32650553 ATGTGCAAAGGCCCTGAGGAAGG + Intergenic
1022806769 7:33830505-33830527 ACGTGCAAAGGCCCTGAGGTCGG + Intergenic
1022918330 7:34984365-34984387 ATGTGCAAAGGCCCTGAGGAAGG + Intronic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023194789 7:37623202-37623224 AAGTCCAAAGGCCCTGATATAGG - Intergenic
1024114142 7:46176498-46176520 ATGGGCAAAGGCCCTGTGGCAGG + Intergenic
1024343812 7:48292637-48292659 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1025256292 7:57385772-57385794 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1026657507 7:72269859-72269881 ATGGCCTAGAGCCTTGATGTTGG + Intronic
1027866885 7:83659475-83659497 ATGCACAAAGGCCCTGAAGTGGG - Intergenic
1028212679 7:88094385-88094407 AAGGCCAGAGGCCTTGATGCAGG + Intronic
1028233765 7:88335980-88336002 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1028711290 7:93911818-93911840 ATGCCAGAAGGACCTGATGTAGG - Intergenic
1028711639 7:93916013-93916035 ATGCCAGAAGGACCTGATGTAGG - Intergenic
1029896698 7:103990522-103990544 ATGACCAATGGCCCTGAAATCGG + Intergenic
1030335719 7:108323933-108323955 AAATCCAAAGGCCCTGAGGTTGG + Intronic
1032863605 7:135904503-135904525 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1034075138 7:148224385-148224407 ATATTCAAAGGCCCTGAGGTAGG + Intronic
1034124909 7:148662758-148662780 ATGTCCAAGGGCCCTGTGGTGGG + Intergenic
1037460164 8:19100975-19100997 ATGGCCCAAGAGCTTGATGTTGG + Intergenic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1038482718 8:27912814-27912836 CTGCCCAAAGACCCTGATGTAGG + Intronic
1038754680 8:30329565-30329587 ATGTCCAAAGTTCCTGAGGTAGG + Intergenic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1041559348 8:59197144-59197166 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1042334825 8:67619250-67619272 AGAGCCAAAGGCCAAGATGTAGG + Intronic
1044067716 8:87719333-87719355 AATGCCAGAGTCCCTGATGTAGG - Intergenic
1044387889 8:91611693-91611715 TTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1044580751 8:93823638-93823660 ATGTGCAAAGGCCCTGATGTGGG + Intergenic
1045219549 8:100185083-100185105 ATGTGCAAAGGCCCTGTGGTAGG - Intronic
1046639151 8:116706333-116706355 AGTGCTAAAGGCCCTGAGGTGGG - Intronic
1046913394 8:119653525-119653547 AGGTGCAAAGGCCCTGAAGTAGG + Intronic
1046970966 8:120223065-120223087 ATGTGCTAAGGCCCTGAGGTGGG + Intronic
1047183881 8:122614604-122614626 AAGTGCAAAGGCCCTCATGTGGG - Intergenic
1047275164 8:123400287-123400309 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1047825135 8:128565133-128565155 ATGTGCAAAGGCCCTGGGGTTGG + Intergenic
1049475345 8:142794606-142794628 ATGTGCAAAGGCCCGGAGGTAGG - Intergenic
1049745764 8:144262675-144262697 AGGGCCAAAGGCTGTGATGCAGG + Intronic
1050271502 9:3950517-3950539 ATGTGCAAATGCCCTGAGGTGGG - Intronic
1050587238 9:7125223-7125245 ATGACCAAAGGCCCAGAAGCAGG - Intergenic
1051114003 9:13673522-13673544 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1051392176 9:16577063-16577085 ATGACCAATAGCCCTGATTTAGG + Intronic
1052023096 9:23546825-23546847 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1053150621 9:35740590-35740612 AGGGTCAAAGGCTGTGATGTGGG + Exonic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1057293464 9:93821560-93821582 ATGTGCAAAGGCCCTGGGGTGGG - Intergenic
1057846168 9:98526365-98526387 ATGCACAAAGGTCCTGAGGTGGG - Intronic
1060290566 9:122299003-122299025 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1061045511 9:128162935-128162957 ATGTTCAAAGGGCCTGAGGTAGG + Intronic
1061850166 9:133410288-133410310 ATGGGCAAATGCCTGGATGTTGG - Intronic
1186730255 X:12402357-12402379 AGGTCCAAAGCCCCTGAGGTGGG + Intronic
1187410811 X:19049092-19049114 AAAGGCAAAGGCCCTGAGGTGGG - Intronic
1187475785 X:19609652-19609674 CTGGCCTAAGGCCTTGCTGTAGG + Intronic
1188484504 X:30668525-30668547 ACGTACAAAGGCCCTGAAGTGGG + Intronic
1189088390 X:38051100-38051122 ATGTTCAAAGGCCCTGAAGTGGG + Intronic
1189351404 X:40278519-40278541 ATGTGCAAAGGCCCTGGGGTGGG + Intergenic
1189386809 X:40543804-40543826 AGGGCCAAGGGCCTTGATGGAGG + Intergenic
1190059782 X:47203242-47203264 ATGGCCAGAGGCCAAGATGAGGG - Intronic
1190862686 X:54358892-54358914 ATGGCCCTCGGCCCTGATGGTGG + Intergenic
1191011362 X:55762894-55762916 AAGTACAAAGTCCCTGATGTGGG + Intergenic
1192131461 X:68555488-68555510 ATGGCCAAAAACCCAGAAGTGGG - Intergenic
1192264081 X:69526796-69526818 ATGTGCCAAGGCCCTGAGGTGGG + Intronic
1192576088 X:72244423-72244445 ATGATCAAAGGCCCTGAGGCAGG + Intronic
1194545664 X:95230659-95230681 CTGGCAACAGGCCCTGGTGTGGG - Intergenic
1195003233 X:100662500-100662522 ATGGGGAAAGGCCCTGCTGGGGG - Intronic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1195402102 X:104472040-104472062 CTGGTCAAAGGCCCAGAGGTGGG + Intergenic
1195751313 X:108163871-108163893 ATGTGCAAAGGCCCTGTGGTAGG + Intronic
1196208222 X:112965421-112965443 ATGGTCAAAGGCCCTGTGGCAGG - Intergenic
1196824625 X:119731467-119731489 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1198105072 X:133454284-133454306 ATGAGCACAGGCTCTGATGTAGG - Intergenic
1198224634 X:134633877-134633899 AGGGCCAAAGGGGCTGATTTGGG + Intronic
1198425568 X:136516378-136516400 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1198453846 X:136795697-136795719 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1198487683 X:137104742-137104764 ATATACAAAGGCCCTGAAGTGGG - Intergenic
1199719713 X:150534013-150534035 ATGTGCAAAGGCCCTGTGGTGGG + Intergenic
1199778291 X:151034819-151034841 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic