ID: 1182681178

View in Genome Browser
Species Human (GRCh38)
Location 22:32081135-32081157
Sequence CTCCTAATGAACCTTCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182681178_1182681182 2 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681182 22:32081160-32081182 GGCTGAAAGAGACAGGAAGGAGG 0: 1
1: 2
2: 4
3: 71
4: 659
1182681178_1182681184 10 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681184 22:32081168-32081190 GAGACAGGAAGGAGGAGAAAGGG 0: 1
1: 4
2: 36
3: 280
4: 2180
1182681178_1182681185 19 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681185 22:32081177-32081199 AGGAGGAGAAAGGGTGAAGATGG 0: 1
1: 1
2: 19
3: 208
4: 1696
1182681178_1182681181 -1 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681181 22:32081157-32081179 GAAGGCTGAAAGAGACAGGAAGG 0: 1
1: 0
2: 4
3: 72
4: 732
1182681178_1182681180 -5 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681180 22:32081153-32081175 AGGAGAAGGCTGAAAGAGACAGG 0: 1
1: 0
2: 4
3: 52
4: 514
1182681178_1182681183 9 Left 1182681178 22:32081135-32081157 CCAGGTAGAAGGTTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1182681183 22:32081167-32081189 AGAGACAGGAAGGAGGAGAAAGG 0: 1
1: 3
2: 42
3: 362
4: 2503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182681178 Original CRISPR CTCCTAATGAACCTTCTACC TGG (reversed) Intronic
902148751 1:14425382-14425404 CTCACAATGAACCTTCTTCTTGG - Intergenic
902210502 1:14901249-14901271 CACCTGCTGCACCTTCTACCTGG - Intronic
904575257 1:31501368-31501390 CTCCAACTGAGCCCTCTACCGGG - Intergenic
909166946 1:72238595-72238617 CTCCTGAGGCACCTTCAACCTGG + Intronic
912064159 1:105714916-105714938 CTTCTATTGAACATTATACCGGG - Intergenic
922136970 1:222838534-222838556 CCTCAAATGATCCTTCTACCTGG - Intergenic
923583839 1:235247664-235247686 GTCCTAATGAACCTTAAATCAGG + Intronic
923912106 1:238460466-238460488 CTCCAAAGGCACCTTCTCCCCGG + Intergenic
1064223030 10:13457781-13457803 CTCCTAATGGAACTGTTACCAGG - Intronic
1064562315 10:16605325-16605347 CTAGGAATGAACCTTCTATCAGG - Intronic
1069635834 10:69924240-69924262 CTCCTGATGAACCTGCTCACGGG - Intronic
1071724987 10:88189765-88189787 CTCTTAATGAATCTTTGACCAGG + Intergenic
1075545177 10:123349924-123349946 GTCCTAATGAACCCACTGCCTGG - Intergenic
1077355827 11:2116447-2116469 CATCTAATGAACCTGCTATCTGG - Intergenic
1079215071 11:18502304-18502326 ATATAAATGAACCTTCTACCAGG - Intronic
1080966017 11:37216432-37216454 CTCCTCATTCACCTTCTGCCAGG - Intergenic
1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG + Intergenic
1087354828 11:97079333-97079355 CTCATTATGAAACTTCTGCCTGG - Intergenic
1094171200 12:27493985-27494007 CTCCTTAAAAAACTTCTACCAGG - Intronic
1094261503 12:28505606-28505628 CTCCTAATGATCCTGATGCCAGG + Intronic
1098249246 12:68551763-68551785 CACGTATTGAAACTTCTACCTGG + Intergenic
1099565571 12:84241025-84241047 CTCCTAAAGAACCTTCACCATGG - Intergenic
1101586716 12:106091492-106091514 CTCATGCTGACCCTTCTACCTGG - Intronic
1102236944 12:111299359-111299381 CTCCTGCTGAGCCTTCTACCTGG - Intronic
1105855417 13:24367362-24367384 CTCCTAATGAAGCTGGAACCAGG - Intergenic
1112258876 13:97859887-97859909 CTTCTAATGAAAGTTCTAGCTGG + Intergenic
1116860083 14:49988097-49988119 CTTCTACTGCACCTTCTCCCTGG - Intronic
1117441840 14:55767070-55767092 CTCCTGTTTAACTTTCTACCTGG + Intergenic
1117452706 14:55866098-55866120 CCCCTCATGAACCTACTACCAGG - Intergenic
1120466589 14:84865471-84865493 CTCATAATAAACCTTTTACTAGG + Intergenic
1120996326 14:90421107-90421129 CTCCAGATGCACCTTCAACCTGG + Intergenic
1121035366 14:90698995-90699017 CTCCTGCTGAACCTCCTTCCAGG + Intronic
1123679631 15:22751438-22751460 GTATTAATGAAACTTCTACCAGG - Intergenic
1124331849 15:28825907-28825929 GTATTAATGAAACTTCTACCAGG - Intergenic
1125068497 15:35522575-35522597 CTCCTCATGAACCTTCAAAAAGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128877249 15:71212578-71212600 ATCCCAATGATCCTTCCACCAGG + Intronic
1128884185 15:71270851-71270873 CTCCTAATATGCCTTCTACATGG - Intronic
1138022647 16:53498413-53498435 GTCCTATGGACCCTTCTACCTGG - Exonic
1144344814 17:14340159-14340181 CGCCTCCTGAACCTTCTCCCAGG + Intronic
1150922672 17:69500056-69500078 CTCATACTGTTCCTTCTACCTGG - Intronic
1162220533 19:9172505-9172527 CTCTTAATGAGCCTTCTACAAGG - Intergenic
1168534623 19:57158624-57158646 CTCCTCTAGAACCTTCCACCTGG - Intronic
926707237 2:15845511-15845533 CTCCTGATGAGCCTGCTCCCTGG - Intergenic
926918925 2:17919899-17919921 CTCCTTACCAACCTCCTACCAGG - Intronic
926988445 2:18649935-18649957 CTCCCTATGAGCCTTCTCCCAGG - Intergenic
930144928 2:47992099-47992121 ATCCTAACCCACCTTCTACCTGG - Intergenic
931987566 2:67756387-67756409 CTTCTACTGCACCTTCAACCTGG + Intergenic
931998133 2:67858427-67858449 CTCTGAATGAACTTTCTACTTGG + Intergenic
944348839 2:198703082-198703104 CTCCTAAAGATCATTCTGCCTGG + Intergenic
946384649 2:219375115-219375137 CTCCGAATGGACCATCTCCCAGG - Intronic
946766608 2:223046467-223046489 CTCCTGCTGCATCTTCTACCAGG + Intergenic
1174011048 20:47449881-47449903 CTCCCAAAGATCCTTTTACCTGG + Intergenic
1174734911 20:52956664-52956686 CTCCTAATGAATTTTCCAGCTGG + Intergenic
1182681178 22:32081135-32081157 CTCCTAATGAACCTTCTACCTGG - Intronic
1183164779 22:36139476-36139498 TTCCTCATGATCCTTCTTCCAGG - Intergenic
1183176083 22:36225687-36225709 TTCCTCATGATCCTTCTTCCAGG - Intergenic
1183182250 22:36268026-36268048 TTCCTCATGATCCTTCTTCCAGG + Intergenic
1183273084 22:36874121-36874143 CTCCTAATGACCCTAGTACCTGG - Intronic
1184292090 22:43502798-43502820 CTCCTAATGGACCCTCCAGCAGG + Intronic
950512542 3:13440049-13440071 CTGCTAATGAATCTTGTCCCTGG - Intergenic
953879539 3:46684482-46684504 CTCATACTGTTCCTTCTACCTGG + Intronic
956675329 3:71726556-71726578 CTCCTCATTGACCTTCTACCTGG + Intronic
959499151 3:107085560-107085582 TTCCTTATTAACCTTCAACCAGG - Intergenic
961072883 3:123952647-123952669 CTCCTTATGTACTTTCTATCTGG - Intronic
971303628 4:25462168-25462190 CTCCTAATGAACCTCTAACCTGG + Intergenic
973184208 4:47305529-47305551 CTCATAATGAACCATTTACTAGG - Intronic
974100795 4:57414025-57414047 CTCCTCATGACCTTTCTGCCAGG + Intergenic
977889492 4:102291741-102291763 CTTCTAATGAACCTGACACCAGG + Intronic
978107897 4:104926807-104926829 ATGCTGATGAAGCTTCTACCTGG - Intergenic
984315705 4:178128783-178128805 TTCTTAATGACCCCTCTACCTGG - Intergenic
984877559 4:184383119-184383141 CTCCTCATGAAACATTTACCTGG + Intergenic
986390597 5:7283228-7283250 GTATTAATGAAACTTCTACCAGG - Intergenic
987088732 5:14492075-14492097 TTCCCAATGAACATTCTATCTGG + Intronic
987912820 5:24170574-24170596 GTCCTATGGACCCTTCTACCTGG + Intronic
993007815 5:82447117-82447139 ATCCTAATGGACCTTCCACATGG + Intergenic
994029506 5:95125427-95125449 CTCCTAAAGACTCTTCTTCCTGG + Intronic
995834798 5:116389123-116389145 CTACTAATCAACCTTCAGCCTGG - Intronic
998473765 5:142403885-142403907 CTCCAAAGGGACCTTCTACCAGG + Intergenic
999544567 5:152613045-152613067 CTCAGAATGAATCTTCTAGCTGG - Intergenic
1006512831 6:34530855-34530877 CTCCTAAGGAACGTGCAACCTGG + Intronic
1006835754 6:36997922-36997944 CTCCTCTTGTACCTTCTTCCAGG - Intergenic
1017674203 6:156796947-156796969 CTCCAAATGCCTCTTCTACCAGG - Intronic
1024287565 7:47772576-47772598 CCCCTACAGAACCTTCTCCCAGG + Intronic
1031988375 7:128178654-128178676 CACTCAATGAACCTTCTTCCTGG + Intergenic
1037268056 8:17090037-17090059 GTCCTCATGACCGTTCTACCAGG + Intronic
1039056976 8:33544696-33544718 TTTCTAAAGAACCTACTACCTGG - Intergenic
1040470445 8:47731814-47731836 CACCTACTCAAACTTCTACCTGG - Intronic
1040674812 8:49735785-49735807 GTCCTAATGAACTTTCTCTCAGG + Intergenic
1057547278 9:96027653-96027675 CTCCACATGCACCTTCTCCCGGG + Intergenic
1057837556 9:98457565-98457587 CTCCTCCTGATCCTTGTACCCGG - Intronic
1062284678 9:135767774-135767796 CTCCTGATGCCCCTCCTACCTGG + Intronic
1186743771 X:12545057-12545079 CTCCTATTGAATTCTCTACCTGG + Intronic
1186775134 X:12857134-12857156 CTCCTATTGAATTCTCTACCTGG - Intergenic
1194732175 X:97468010-97468032 GACCTAATGAACCTTCAGCCTGG - Intronic
1198452707 X:136783702-136783724 ATCCTAATGAACTCTCTAACAGG + Intergenic
1198881822 X:141290060-141290082 ATACTATTGAACCTTCTGCCTGG - Intergenic
1200684320 Y:6245887-6245909 TTCCTTATGTACCATCTACCTGG + Intergenic
1201048314 Y:9908499-9908521 TTCCTTATGTACCATCTACCTGG - Intergenic