ID: 1182685736

View in Genome Browser
Species Human (GRCh38)
Location 22:32120862-32120884
Sequence CCTAACATGCCCCCCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182685730_1182685736 10 Left 1182685730 22:32120829-32120851 CCCGTTGCCGAGAGTGCAGCACC No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685731_1182685736 9 Left 1182685731 22:32120830-32120852 CCGTTGCCGAGAGTGCAGCACCA No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685725_1182685736 21 Left 1182685725 22:32120818-32120840 CCGCCACCCACCCCGTTGCCGAG No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685726_1182685736 18 Left 1182685726 22:32120821-32120843 CCACCCACCCCGTTGCCGAGAGT No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685732_1182685736 3 Left 1182685732 22:32120836-32120858 CCGAGAGTGCAGCACCAGATAGC No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685729_1182685736 11 Left 1182685729 22:32120828-32120850 CCCCGTTGCCGAGAGTGCAGCAC No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685728_1182685736 14 Left 1182685728 22:32120825-32120847 CCACCCCGTTGCCGAGAGTGCAG No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685724_1182685736 25 Left 1182685724 22:32120814-32120836 CCAACCGCCACCCACCCCGTTGC No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685723_1182685736 26 Left 1182685723 22:32120813-32120835 CCCAACCGCCACCCACCCCGTTG No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data
1182685727_1182685736 15 Left 1182685727 22:32120824-32120846 CCCACCCCGTTGCCGAGAGTGCA No data
Right 1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182685736 Original CRISPR CCTAACATGCCCCCCATCAC TGG Intergenic
No off target data available for this crispr