ID: 1182686883

View in Genome Browser
Species Human (GRCh38)
Location 22:32128071-32128093
Sequence CCTTCTGTGCTGAATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182686883_1182686895 26 Left 1182686883 22:32128071-32128093 CCCACCACATTCAGCACAGAAGG No data
Right 1182686895 22:32128120-32128142 CACCTAGCCAGGAAATGAGTTGG No data
1182686883_1182686892 15 Left 1182686883 22:32128071-32128093 CCCACCACATTCAGCACAGAAGG No data
Right 1182686892 22:32128109-32128131 TGCTCTGCCCGCACCTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182686883 Original CRISPR CCTTCTGTGCTGAATGTGGT GGG (reversed) Intergenic
No off target data available for this crispr