ID: 1182687812

View in Genome Browser
Species Human (GRCh38)
Location 22:32134339-32134361
Sequence GTGAGTTAACTGGAGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182687804_1182687812 8 Left 1182687804 22:32134308-32134330 CCCAGATGCCGACAGGTCAGGTG No data
Right 1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG 0: 3
1: 0
2: 0
3: 12
4: 113
1182687808_1182687812 0 Left 1182687808 22:32134316-32134338 CCGACAGGTCAGGTGGTGATGGA No data
Right 1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG 0: 3
1: 0
2: 0
3: 12
4: 113
1182687805_1182687812 7 Left 1182687805 22:32134309-32134331 CCAGATGCCGACAGGTCAGGTGG No data
Right 1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG 0: 3
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182687812 Original CRISPR GTGAGTTAACTGGAGTAGGT GGG Intergenic
903267294 1:22165445-22165467 GTGAGTTAACTGGCCTAGGATGG + Intergenic
905433363 1:37940615-37940637 GAGAGTCAACTGGGGTGGGTAGG + Intronic
906510413 1:46407467-46407489 GTGTGTTATTTGGAGGAGGTGGG + Intronic
910680824 1:89862594-89862616 GTGAGTTAACTCTAGGAGATGGG + Intronic
912281264 1:108316863-108316885 GTGGGTTAACCAGAGAAGGTAGG - Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
915748066 1:158180509-158180531 TTGAGAGAACTGGATTAGGTTGG - Intronic
915748298 1:158181896-158181918 GTAAGTGACCTGGAGTAGGCAGG - Intronic
915773905 1:158461570-158461592 GTGACTTATCTGGAGAAGCTGGG + Intergenic
918687284 1:187433623-187433645 GTGACTTCACTGGAGTATGTTGG + Intergenic
919310415 1:195899844-195899866 GTGAGTTAACTGGACTCAGATGG + Intergenic
919345204 1:196366928-196366950 GAAAATTAAGTGGAGTAGGTTGG + Intronic
920536802 1:206742740-206742762 GGGAGGTAGCAGGAGTAGGTGGG + Intergenic
921577027 1:216847421-216847443 ATGATTTAACTGGAGTAGAAAGG + Intronic
1063036300 10:2289781-2289803 GTGTGTTGACTGCAGTTGGTCGG - Intergenic
1075581114 10:123619265-123619287 GAGAGGAAACTGGAGTTGGTGGG + Intergenic
1077504219 11:2922678-2922700 GTGGGTTGAGTGGAGTGGGTGGG + Intronic
1080408970 11:32005632-32005654 GTGAGTTGACTGGACTCAGTGGG + Intronic
1081111991 11:39147349-39147371 AAGAGTTAACTGGAGTAGAGTGG + Intergenic
1084209248 11:67613431-67613453 GTGAGTGAACTGGGGTAGGCAGG - Intergenic
1086308996 11:85515086-85515108 GTCAGATAACTGGAGTTGGTAGG + Intronic
1086424485 11:86670941-86670963 GTGAGTTAATTTGAGGAGGTAGG + Intronic
1086963276 11:93002116-93002138 GTGACTTAACTGGTTTAGGGTGG + Intergenic
1088564587 11:111155371-111155393 GTGAGTATACTGGAGTAAGGTGG - Intergenic
1090768774 11:129900052-129900074 GTGAGTATTTTGGAGTAGGTTGG - Exonic
1091693110 12:2610486-2610508 GTTAGTTAACTGGAGGGTGTGGG - Intronic
1092900143 12:13051571-13051593 GTTTGCTATCTGGAGTAGGTAGG + Intronic
1109177960 13:59178589-59178611 GGGAGTTAACTGGGGAAGGAGGG - Intergenic
1116261500 14:42634156-42634178 GTGAGTTAATTGGAGTTATTTGG + Intergenic
1117971747 14:61257996-61258018 GTGTTTTAACTGGAGAAGGCTGG + Intronic
1121013769 14:90536172-90536194 GTGAGCTTCCTGGAGGAGGTGGG - Exonic
1124826477 15:33101269-33101291 TTGAGTATACTGGAGGAGGTTGG + Intronic
1128589834 15:68886061-68886083 GAGAGTTAACTGCAGTGGATAGG - Intronic
1128998548 15:72314956-72314978 ATGATTTAACTGGAGGAGATAGG - Intronic
1130553509 15:84906973-84906995 ATGAGTTGAGTGGAGGAGGTTGG + Intronic
1131794954 15:96006900-96006922 GTGAGTTACGTGGGTTAGGTGGG - Intergenic
1135247083 16:20866424-20866446 GTGAGTGGCCTGGGGTAGGTGGG - Intronic
1137741401 16:50779732-50779754 GTGAGTTCACAGGAGGAGGCTGG - Exonic
1139659776 16:68412564-68412586 GTGTGTTAAATGAAGCAGGTAGG - Intronic
1140562099 16:75995444-75995466 GAGAGTTAACGGGAGTAGGAAGG + Intergenic
1148317433 17:46715307-46715329 GTGATTTCCCTAGAGTAGGTAGG + Intronic
1149237047 17:54604641-54604663 TTGATTTATCTGAAGTAGGTGGG + Intergenic
1150941237 17:69696830-69696852 GAAAGTTTTCTGGAGTAGGTTGG + Intergenic
1152300942 17:79495160-79495182 GTGAGTTACCTGGCTTACGTCGG + Intronic
1155916684 18:31564571-31564593 GGGAGTGAACTGGAGTATGCGGG - Intergenic
1156020962 18:32598539-32598561 GGGAGTTAACTGGACTCTGTGGG - Intergenic
1159665562 18:71155660-71155682 GTGAGTTATCAGGGGTGGGTGGG - Intergenic
1167842256 19:52131629-52131651 GTGAGCTAAGGGGAGGAGGTTGG + Intronic
924990559 2:309345-309367 GTGAGCTAAAAGCAGTAGGTGGG + Intergenic
928363248 2:30682260-30682282 GTGGGCTACCTGGAGGAGGTAGG - Intergenic
930659616 2:54040767-54040789 GTGATTTAACTGAAGTGGATTGG + Intronic
931785409 2:65613585-65613607 GTGAGATAACAGTTGTAGGTGGG + Intergenic
932252386 2:70255865-70255887 ATGAGTTGAGTGGAGGAGGTTGG + Intergenic
936634724 2:114242856-114242878 GGGAGGTAACTGGATTAGGGGGG - Intergenic
937132210 2:119522396-119522418 GTGGGTTAAGTGGGGTATGTGGG + Intronic
937482804 2:122280165-122280187 GTTAGTTATCTAGAGGAGGTGGG - Intergenic
937707486 2:124937721-124937743 GTAAGTTTTCTGGAGCAGGTTGG - Intergenic
944363007 2:198880768-198880790 CTCAGTTAACTGGAGCAGGAAGG + Intergenic
944561288 2:200941037-200941059 GTGAGTTCACTTGACTAGGAAGG - Intronic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948669471 2:239558795-239558817 GTGAGTCAGCTGGCGTGGGTGGG - Intergenic
1170127574 20:12982245-12982267 GTGAGTTGTCTGGAGTGAGTGGG - Intergenic
1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG + Intronic
1173693631 20:44986812-44986834 GTGGGAGAAGTGGAGTAGGTTGG + Intronic
1174190235 20:48735263-48735285 GTGAGGTCACTGGAGGAGGAAGG + Intronic
1175249764 20:57602170-57602192 GTGAGCTAAGGGGAGTGGGTAGG + Intergenic
1177204419 21:17994887-17994909 ATGGGGTTACTGGAGTAGGTGGG + Intronic
1177965633 21:27722914-27722936 GTTGGTTCACTGGAGTAAGTAGG + Intergenic
1182305142 22:29362771-29362793 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182312452 22:29418925-29418947 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG + Intergenic
952244597 3:31573034-31573056 ATGAGTTAACTGGGATAGGGAGG + Intronic
954595925 3:51824451-51824473 GTGAGTTTACTAGATTATGTTGG - Intronic
955646942 3:61149984-61150006 GTAAATTAACTGGAGAGGGTTGG - Intronic
958644684 3:96854796-96854818 TTGAGTTAAATGGAATTGGTAGG + Intronic
958841297 3:99208915-99208937 GGGAGGTGACTGGATTAGGTGGG - Intergenic
960141924 3:114159399-114159421 GTGAGCTGACTGGGGTTGGTAGG - Intronic
963704311 3:148666648-148666670 GTGATTTAACTGGATCAGTTTGG - Intergenic
964899000 3:161634873-161634895 ATGAGTTGAGTGGAGGAGGTTGG + Intergenic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
972893940 4:43595618-43595640 ATGAGTTTAGTGGAGGAGGTTGG - Intergenic
975589323 4:75984827-75984849 GGGAGTTCACTGGACCAGGTAGG - Intronic
976656087 4:87490075-87490097 CTGATTTAACTGAACTAGGTTGG - Intronic
976736707 4:88317482-88317504 GTGACTTATCTGGAGTAGCTGGG - Intergenic
982036148 4:151348035-151348057 GTGGGTTCACAGGAGTAGGAAGG + Intergenic
982381626 4:154755135-154755157 GTGAGTTAGCGGCAGTAGGTGGG - Intergenic
982861443 4:160455279-160455301 GTGAGGAAACTAGAGTAGCTGGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
988931208 5:36037291-36037313 ATGATGTAACTGGGGTAGGTGGG + Intronic
989300293 5:39883756-39883778 CTGAGTTAGCTGGAGTAGAGAGG - Intergenic
989315456 5:40072729-40072751 ATGAGTGAATTGGAGTAGATGGG - Intergenic
990561977 5:56992368-56992390 GTGAGGGAGCAGGAGTAGGTTGG + Intergenic
992140946 5:73796420-73796442 GTGAGATTAATGGAGAAGGTGGG + Intronic
999408211 5:151325810-151325832 ATGAGGTACCTGGAGTAGGTAGG + Intronic
1002575821 5:180173063-180173085 GTGACTTAACTGGAGCAGGCAGG - Intronic
1004688719 6:17973554-17973576 TTGAGTTAAATAGAGTAAGTAGG - Intronic
1006330972 6:33390857-33390879 GTGAGTTAACAGAAATAGCTTGG + Intergenic
1007162450 6:39802677-39802699 GAGAGTTGAGTGGACTAGGTAGG - Intronic
1008590680 6:52990532-52990554 GTGATTGGACTGGGGTAGGTGGG + Intronic
1012597221 6:101054540-101054562 GTGAGATCACTGCAGAAGGTGGG - Intergenic
1013465137 6:110411219-110411241 GTGAGCTCACTGGAGTAAGAGGG - Intronic
1014194846 6:118543074-118543096 ATGAGCTAAGTGGAGGAGGTGGG - Intronic
1020854747 7:13404843-13404865 GTGAGGTAACTGTAGTAGACTGG + Intergenic
1022098201 7:27153864-27153886 TTGAGTTAACTGTAGTGGGTGGG - Exonic
1023621486 7:42077680-42077702 GTGAGTTACTAGGAGTAAGTGGG - Intronic
1024565127 7:50674345-50674367 GTGAGTTAAATGGTGTTGGGGGG - Intronic
1027949803 7:84800619-84800641 CTGATTTAATTGGATTAGGTGGG + Intergenic
1030991765 7:116309528-116309550 GGGAGTTCAGTGGAGGAGGTGGG + Intronic
1038938322 8:32276825-32276847 GGGAGATAACTGGAGTAGTCTGG + Intronic
1041244366 8:55876550-55876572 TTGATTTAACTGGTCTAGGTAGG + Intergenic
1041350340 8:56942039-56942061 CAGAGTAAAATGGAGTAGGTTGG + Intergenic
1041788155 8:61658979-61659001 GTGCGATAACTGGAGTGTGTGGG + Intronic
1042260171 8:66850440-66850462 GTGTTATTACTGGAGTAGGTGGG - Intronic
1044834341 8:96281090-96281112 GTGACTTGACTGGAGTAGCCAGG + Intronic
1044979429 8:97700772-97700794 GTTAGTTAAATGGAGGAGGGTGG + Intronic
1046426946 8:114066096-114066118 GAGAGATAAATGGAGGAGGTTGG + Intergenic
1050477314 9:6053530-6053552 GTGAGATGACTGGAGGAGGGAGG + Intergenic
1051998362 9:23247481-23247503 GTGAGATAAATGCAGAAGGTGGG + Intergenic
1054712852 9:68528987-68529009 GTGGGTTTTCTGGAGGAGGTGGG - Intronic
1057321182 9:94014444-94014466 GTGAGTTAACAGGGGGAGGGAGG - Intergenic
1188196622 X:27242343-27242365 GTGAATTAACTAGAGTATGAAGG + Intergenic
1189314037 X:40041159-40041181 GTGTCTTGACTGGAGTAGCTGGG + Intergenic
1190287520 X:48971130-48971152 GAGAGTTATCTGGGGGAGGTGGG + Exonic
1201099858 Y:10663270-10663292 GTGAGTGAAGTGGAGTAGAGTGG - Intergenic
1201128646 Y:10936023-10936045 GTGAGTGAAGTGGAGTAGATTGG - Intergenic
1202261003 Y:22970243-22970265 GTGAGTCAACAGGAGCATGTAGG + Intergenic
1202413991 Y:24603984-24604006 GTGAGTCAACAGGAGCATGTAGG + Intergenic
1202456793 Y:25066102-25066124 GTGAGTCAACAGGAGCATGTAGG - Intergenic