ID: 1182688193

View in Genome Browser
Species Human (GRCh38)
Location 22:32136914-32136936
Sequence CTTTCCTGCACCACAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182688193_1182688202 15 Left 1182688193 22:32136914-32136936 CCTGCAGCTGTGGTGCAGGAAAG No data
Right 1182688202 22:32136952-32136974 CGGTGGGCATTTGCTCAGCAGGG 0: 2
1: 0
2: 0
3: 6
4: 109
1182688193_1182688195 -2 Left 1182688193 22:32136914-32136936 CCTGCAGCTGTGGTGCAGGAAAG No data
Right 1182688195 22:32136935-32136957 AGCTGAACCCCTGACTCCGGTGG 0: 2
1: 0
2: 1
3: 11
4: 186
1182688193_1182688201 14 Left 1182688193 22:32136914-32136936 CCTGCAGCTGTGGTGCAGGAAAG No data
Right 1182688201 22:32136951-32136973 CCGGTGGGCATTTGCTCAGCAGG No data
1182688193_1182688194 -5 Left 1182688193 22:32136914-32136936 CCTGCAGCTGTGGTGCAGGAAAG No data
Right 1182688194 22:32136932-32136954 GAAAGCTGAACCCCTGACTCCGG No data
1182688193_1182688196 -1 Left 1182688193 22:32136914-32136936 CCTGCAGCTGTGGTGCAGGAAAG No data
Right 1182688196 22:32136936-32136958 GCTGAACCCCTGACTCCGGTGGG 0: 2
1: 0
2: 0
3: 4
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182688193 Original CRISPR CTTTCCTGCACCACAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr