ID: 1182688779

View in Genome Browser
Species Human (GRCh38)
Location 22:32141448-32141470
Sequence GGCAGCGCTCCCGAGTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182688779_1182688783 -2 Left 1182688779 22:32141448-32141470 CCCTGCTACTCGGGAGCGCTGCC No data
Right 1182688783 22:32141469-32141491 CCACTGCCCTGGCCAAGAACTGG 0: 2
1: 0
2: 1
3: 22
4: 227
1182688779_1182688790 29 Left 1182688779 22:32141448-32141470 CCCTGCTACTCGGGAGCGCTGCC No data
Right 1182688790 22:32141500-32141522 TCTAGTTGAAACATATTTCTGGG 0: 2
1: 0
2: 1
3: 20
4: 297
1182688779_1182688784 -1 Left 1182688779 22:32141448-32141470 CCCTGCTACTCGGGAGCGCTGCC No data
Right 1182688784 22:32141470-32141492 CACTGCCCTGGCCAAGAACTGGG 0: 2
1: 0
2: 1
3: 13
4: 224
1182688779_1182688789 28 Left 1182688779 22:32141448-32141470 CCCTGCTACTCGGGAGCGCTGCC No data
Right 1182688789 22:32141499-32141521 GTCTAGTTGAAACATATTTCTGG 0: 2
1: 0
2: 0
3: 18
4: 165
1182688779_1182688785 0 Left 1182688779 22:32141448-32141470 CCCTGCTACTCGGGAGCGCTGCC No data
Right 1182688785 22:32141471-32141493 ACTGCCCTGGCCAAGAACTGGGG 0: 2
1: 0
2: 4
3: 21
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182688779 Original CRISPR GGCAGCGCTCCCGAGTAGCA GGG (reversed) Intergenic
No off target data available for this crispr