ID: 1182689176

View in Genome Browser
Species Human (GRCh38)
Location 22:32144597-32144619
Sequence CCTATCAGGAACCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182689168_1182689176 13 Left 1182689168 22:32144561-32144583 CCATCTGTTTCTCACAACGTACC No data
Right 1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG No data
1182689170_1182689176 -8 Left 1182689170 22:32144582-32144604 CCCCAGGTCCTCACACCTATCAG No data
Right 1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG No data
1182689173_1182689176 -10 Left 1182689173 22:32144584-32144606 CCAGGTCCTCACACCTATCAGGA No data
Right 1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG No data
1182689171_1182689176 -9 Left 1182689171 22:32144583-32144605 CCCAGGTCCTCACACCTATCAGG No data
Right 1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182689176 Original CRISPR CCTATCAGGAACCTGAAGCC AGG Intergenic
No off target data available for this crispr