ID: 1182690966

View in Genome Browser
Species Human (GRCh38)
Location 22:32162295-32162317
Sequence ATGGTCTCTTTTGTGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690966_1182690976 10 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690976 22:32162328-32162350 ACAGGGAGTGTTATCACAGGAGG No data
1182690966_1182690972 -7 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690972 22:32162311-32162333 AGACCATAAAAGGGGCCACAGGG No data
1182690966_1182690977 17 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347
1182690966_1182690974 7 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG 0: 2
1: 0
2: 0
3: 9
4: 109
1182690966_1182690971 -8 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690971 22:32162310-32162332 GAGACCATAAAAGGGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690966 Original CRISPR ATGGTCTCTTTTGTGGTCAC AGG (reversed) Intergenic
No off target data available for this crispr