ID: 1182690968

View in Genome Browser
Species Human (GRCh38)
Location 22:32162302-32162324
Sequence CCCTTTTATGGTCTCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690968_1182690974 0 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG 0: 2
1: 0
2: 0
3: 9
4: 109
1182690968_1182690976 3 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690976 22:32162328-32162350 ACAGGGAGTGTTATCACAGGAGG No data
1182690968_1182690978 29 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG 0: 2
1: 0
2: 2
3: 9
4: 115
1182690968_1182690977 10 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690968 Original CRISPR CCCTTTTATGGTCTCTTTTG TGG (reversed) Intergenic
No off target data available for this crispr