ID: 1182690973

View in Genome Browser
Species Human (GRCh38)
Location 22:32162314-32162336
Sequence ACTCCCTGTGGCCCCTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690973_1182690976 -9 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690976 22:32162328-32162350 ACAGGGAGTGTTATCACAGGAGG No data
1182690973_1182690980 23 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690980 22:32162360-32162382 GCTTCAAAAAGCAGAGGAGTGGG No data
1182690973_1182690977 -2 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347
1182690973_1182690981 24 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690981 22:32162361-32162383 CTTCAAAAAGCAGAGGAGTGGGG No data
1182690973_1182690982 25 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690982 22:32162362-32162384 TTCAAAAAGCAGAGGAGTGGGGG No data
1182690973_1182690978 17 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG 0: 2
1: 0
2: 2
3: 9
4: 115
1182690973_1182690979 22 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690979 22:32162359-32162381 TGCTTCAAAAAGCAGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690973 Original CRISPR ACTCCCTGTGGCCCCTTTTA TGG (reversed) Intergenic
No off target data available for this crispr