ID: 1182690974

View in Genome Browser
Species Human (GRCh38)
Location 22:32162325-32162347
Sequence GCCACAGGGAGTGTTATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690965_1182690974 8 Left 1182690965 22:32162294-32162316 CCCTGTGACCACAAAAGAGACCA No data
Right 1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG 0: 2
1: 0
2: 0
3: 9
4: 109
1182690968_1182690974 0 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG 0: 2
1: 0
2: 0
3: 9
4: 109
1182690966_1182690974 7 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG 0: 2
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690974 Original CRISPR GCCACAGGGAGTGTTATCAC AGG Intergenic
903004646 1:20290694-20290716 GCCCGAAGGACTGTTATCACAGG + Intergenic
905320335 1:37111817-37111839 GCCACAGGCAGTGGTAGCAGTGG + Intergenic
917376515 1:174353473-174353495 GCCACAAGGACTGTAATCCCTGG - Intronic
918664408 1:187131628-187131650 GCTTCAGGGAGTGTTACAACTGG + Intergenic
922207447 1:223460988-223461010 AACACAGTGAGTGTTAGCACTGG - Intergenic
923673840 1:236064251-236064273 GCCACAGGAAATGGGATCACTGG + Intronic
1063390517 10:5647365-5647387 GCCAAAGTGACTGTTAGCACAGG - Intronic
1064981314 10:21170291-21170313 CCCAAAGGCATTGTTATCACTGG + Intronic
1067958735 10:50823499-50823521 GCCAAAGGGAAGGTTATCAGAGG + Intronic
1071430608 10:85603463-85603485 ACCACAGTGGGTGATATCACAGG + Intronic
1071958567 10:90785621-90785643 GCCACAGGCAGTGTTAAGATTGG - Intronic
1073008215 10:100340521-100340543 GCAGCAGGGAATGTGATCACGGG + Intergenic
1075382757 10:122032333-122032355 GCGACGGGGAGTGTGCTCACTGG - Intronic
1076943239 10:133624339-133624361 CCCACAGGGAGTGCTATTAATGG + Intronic
1084763932 11:71295172-71295194 GCCACAAGGACTGTAATCCCTGG - Intergenic
1090364479 11:126194174-126194196 GCCACGGTGAGGGTTATCAGGGG + Intergenic
1090606172 11:128424907-128424929 GCAACAGCGTGTGATATCACTGG - Intergenic
1099100980 12:78439866-78439888 GCCACAGTGAGTGCAATCCCTGG - Intergenic
1109731203 13:66416609-66416631 GCAGCAGGGAGTTTTATCATGGG + Intronic
1121958224 14:98234346-98234368 GTCACAGGGAGTGTGATGATTGG - Intergenic
1129278155 15:74461141-74461163 GCCAGAGTGAGTGTTTACACCGG - Intronic
1129294318 15:74591571-74591593 GGCACAGGCACTGTTGTCACTGG - Exonic
1130387581 15:83425089-83425111 GCCACAGCGACTGTTATGAGAGG + Intergenic
1138082818 16:54107948-54107970 GCCACAGGGAGTGGTTTAAGAGG - Intronic
1138578794 16:57926182-57926204 GCCCCAGGGTGTGTTCTCAGAGG - Intronic
1140332027 16:74067640-74067662 GACACAGGGAATGGTATCCCAGG - Intergenic
1141848322 16:86626487-86626509 ACCACAGGGAGTGCCATCCCGGG + Intergenic
1143632768 17:8148264-8148286 GGCACAGAGAGTGTGGTCACTGG + Intronic
1150489420 17:65563999-65564021 GCCACAGAGGGTGTTATTACTGG + Intronic
1150699381 17:67434238-67434260 GGCACAGGGAGGGGTAACACAGG - Intronic
1150771347 17:68043853-68043875 GCCATAGGGAATATTGTCACTGG + Exonic
1155555199 18:27011099-27011121 GCCACAGGAAGATTTATCTCTGG + Intronic
1159096052 18:63903171-63903193 GGCACAGGAGGTGTTATGACAGG + Exonic
1160383475 18:78478638-78478660 GCTACAGGGAGTGAAATCATTGG + Intergenic
1164078323 19:21841082-21841104 GGTACAGAGAGTGTTATCATAGG - Intronic
1164087401 19:21915954-21915976 GGTACAGAGAGTGTCATCACAGG + Intergenic
1164098243 19:22031098-22031120 GATACAGAGAGTGTCATCACAGG - Intergenic
1164100370 19:22049636-22049658 GGTACAGAGAGTGTCATCACAGG - Intergenic
1164118167 19:22241985-22242007 GATACAGAGAGTGTCATCACAGG - Intergenic
1164201544 19:23023143-23023165 GCCACAAAGAGTGTCTTCACAGG - Intergenic
1164234455 19:23319993-23320015 GGTACAGAGAGTGTCATCACAGG + Intronic
1164260255 19:23563156-23563178 GTTAGAGAGAGTGTTATCACAGG - Intronic
1164294959 19:23901761-23901783 GGCACAGAGAGTGTCATCAAGGG + Intergenic
1164302775 19:23976556-23976578 GGTACAGAGAGTGTCATCACAGG - Intergenic
1164304592 19:23994332-23994354 GTTACAGATAGTGTTATCACAGG + Intergenic
1164313770 19:24068958-24068980 GGCACAGAGAGTGTCATCAAGGG + Intronic
1166438007 19:42785985-42786007 GCCACAGGTAATGTTATCAGAGG + Intronic
1166456960 19:42949777-42949799 GCCACAGGTAATGTTATCAGAGG + Intronic
1166466910 19:43040648-43040670 GCCACAGGTAATGTTATCAGAGG + Intronic
1166473041 19:43096723-43096745 GCCACAGGTAATGTTATCAGAGG + Intronic
1166486713 19:43220262-43220284 GTCACAGGTAATGTTATCAGAGG + Intronic
1166493824 19:43283710-43283732 GCCACAGGTAATGTTATCAGAGG + Intergenic
931096441 2:58945959-58945981 GCCTCAGGCAGTTTCATCACAGG + Intergenic
932889406 2:75579222-75579244 GCCACAGGGACTGTAATTGCTGG + Intergenic
935691244 2:105734232-105734254 GCCACAGGGACTGTTTTCCTTGG + Intergenic
937344102 2:121112744-121112766 GCCAGGGGGTGTGTTCTCACTGG - Intergenic
938206992 2:129432243-129432265 GCCAAAGTGAGTGATGTCACTGG - Intergenic
938881505 2:135594158-135594180 GCTAAAGGAAGTGTTTTCACTGG - Intronic
939868453 2:147501621-147501643 GCCAGAGTCTGTGTTATCACAGG - Intergenic
944006529 2:194914667-194914689 GCGACAGGGACTGTCATCATTGG - Intergenic
1170791551 20:19513067-19513089 GCCACAGGGTGTTTTGGCACTGG - Intronic
1171780619 20:29414519-29414541 CCCACAGGGAGTGCTATTAATGG + Intergenic
1175460907 20:59151271-59151293 GCCTCAGGAAGGGTTATCCCAGG - Intergenic
1175752578 20:61509327-61509349 GCCCCAGGGAATATTAACACGGG + Intronic
1176338186 21:5618527-5618549 GGTACAAAGAGTGTTATCACAGG + Intergenic
1176339594 21:5681600-5681622 GGTACAAAGAGTGTTATCACAGG + Intergenic
1176471848 21:7113753-7113775 GGTACAAAGAGTGTTATCACAGG + Intergenic
1176495409 21:7495531-7495553 GGTACAAAGAGTGTTATCACAGG + Intergenic
1176505233 21:7642856-7642878 GGTACAAAGAGTGTTATCACAGG - Intergenic
1180694767 22:17744611-17744633 CCCACAGGGAGTGGTGGCACTGG + Intronic
1182310258 22:29399700-29399722 GCCACAGGGAGTGTTATCACAGG - Intronic
1182690974 22:32162325-32162347 GCCACAGGGAGTGTTATCACAGG + Intergenic
950960517 3:17100780-17100802 GCCTCAGGTAGTGTTCTCACAGG - Intergenic
954428567 3:50456873-50456895 GCCACAAGGAGTGTTATGAAGGG - Intronic
956834597 3:73086041-73086063 TCCAAAGGGTGTGTTACCACTGG + Intergenic
957084397 3:75666747-75666769 CCCACAGGGAGTGCTATTAATGG - Exonic
961094639 3:124143976-124143998 GCCAGAGGGAGTGTTCTCCTTGG + Intronic
963745208 3:149118585-149118607 GCCTCTGGGAGAGGTATCACAGG - Intergenic
968471575 4:784946-784968 GCCACACGGTGTGAAATCACTGG + Exonic
974029481 4:56763317-56763339 GGCACAGGGATTGTGAGCACAGG + Intergenic
980305464 4:131054944-131054966 ACCACAGGAAGAGTCATCACCGG - Intergenic
981943178 4:150308576-150308598 CCAAAAGGCAGTGTTATCACAGG + Intronic
984607762 4:181804893-181804915 GGCACCGGGAGTTTTCTCACAGG - Intergenic
985008738 4:185560648-185560670 GCCTCAGGGAGTTTTATTATGGG - Intergenic
985446595 4:190024797-190024819 CCCACAGGGAGTGCTATTAATGG + Exonic
986056856 5:4146658-4146680 GCCACATGGACAGTTGTCACTGG - Intergenic
992281932 5:75187430-75187452 GCCACTGAGAATGTTAACACTGG + Intronic
994624476 5:102201072-102201094 GTCACAGGGAGGTTTATCTCAGG + Intergenic
999646154 5:153718862-153718884 GCCAGATGCAGTGTTATGACTGG + Intronic
1001205968 5:169763485-169763507 GCCAGATGGAGTGCTAGCACGGG + Intronic
1003540207 6:7011821-7011843 GACACAGGCAGGGGTATCACGGG + Intergenic
1004131771 6:12927701-12927723 GCCCCAGGCATTGTCATCACGGG - Intronic
1004891302 6:20103151-20103173 TCCAGAGGCACTGTTATCACAGG + Intronic
1006799690 6:36752074-36752096 GCAGCAGGGAGTGTTGTCATGGG + Intronic
1006809199 6:36809084-36809106 CCCACAGGGAGTGTTAACAAGGG - Intronic
1013761790 6:113527158-113527180 GACAGAGGGAGTGTTAGCTCTGG - Intergenic
1016413264 6:143805979-143806001 GTCACAGGGAGTGACTTCACTGG - Intronic
1018372825 6:163184398-163184420 GCCACATGAAATGTTATCAGGGG - Intronic
1019914998 7:4127489-4127511 GCTACAAGGTGTGTGATCACAGG + Exonic
1022499301 7:30872616-30872638 GACACAGGGAGTGATGTCTCAGG + Intronic
1025744508 7:64231077-64231099 GGCACAGAGAGTGTCATAACAGG - Intronic
1025751677 7:64299295-64299317 GGCACAGAGAGTGTCATAACAGG - Intergenic
1025784305 7:64630605-64630627 GGTACAGGGAGTGTCATTACAGG + Intergenic
1032374875 7:131403366-131403388 GCTTAAGGGAGTGTTATGACTGG + Intronic
1036043180 8:5109431-5109453 GCAATAGGAAGTGTTTTCACTGG + Intergenic
1036098531 8:5751845-5751867 TCCACAGGGAGTTATTTCACGGG - Intergenic
1037121217 8:15289637-15289659 TCCACAGTGAGTGTTATCTGAGG + Intergenic
1038424497 8:27455691-27455713 GCCACAGGGCTTGTTCTCCCTGG - Intronic
1042752833 8:72176913-72176935 GCAACAAGAAGTTTTATCACGGG - Intergenic
1043626714 8:82270582-82270604 GCCACAGGTAGTGTTGATACAGG - Intergenic
1046103333 8:109639822-109639844 ACTACAGGGAGTGTTAACGCTGG - Intronic
1058322161 9:103646051-103646073 GCCACAGAGATTGTTTACACTGG + Intergenic
1058650357 9:107170182-107170204 GCCATAGGGAATATTGTCACTGG - Intergenic
1059998998 9:119941600-119941622 GCCACAGGGGGTGTCAGCAGTGG - Intergenic
1203423478 Un_GL000195v1:16391-16413 GGTACAAAGAGTGTTATCACAGG - Intergenic
1188904179 X:35772555-35772577 GGCACAGGGAGTCTTACCAAGGG - Intergenic
1190869297 X:54411743-54411765 GCCACACTGAGTGTTAAAACTGG - Intergenic
1193483773 X:82060358-82060380 GCCAGTGGAAGTGTTACCACAGG - Intergenic
1194130710 X:90078455-90078477 GACACAGAGACTGTTACCACAGG + Intergenic
1196131928 X:112166158-112166180 GGCACTTGGAGTGTTTTCACTGG - Intergenic