ID: 1182690977

View in Genome Browser
Species Human (GRCh38)
Location 22:32162335-32162357
Sequence GTGTTATCACAGGAGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 2, 1: 0, 2: 2, 3: 36, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690968_1182690977 10 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347
1182690965_1182690977 18 Left 1182690965 22:32162294-32162316 CCCTGTGACCACAAAAGAGACCA No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347
1182690973_1182690977 -2 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347
1182690966_1182690977 17 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG 0: 2
1: 0
2: 2
3: 36
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690977 Original CRISPR GTGTTATCACAGGAGGAAAA CGG Intergenic
900810149 1:4795735-4795757 GGGTTATCTCAGGAAGCAAAGGG + Intergenic
900837176 1:5013984-5014006 CTGGCATCACAGGAGGAAAGGGG + Intergenic
901704470 1:11062966-11062988 GTGTTATTATAAAAGGAAAAAGG + Intergenic
903658184 1:24961487-24961509 GTGTTCTCTCATGAGTAAAAGGG - Intronic
905012424 1:34756393-34756415 ATGTTATGTCAGGAGGAAAAGGG + Intronic
905146161 1:35888354-35888376 CTCTTATCAGAGGAGGAACAAGG - Intronic
905182039 1:36173275-36173297 GCATTGTCACAGGAGGAAGAAGG + Intronic
905338081 1:37259075-37259097 GTGTAAACAGAGTAGGAAAATGG + Intergenic
906716885 1:47976895-47976917 GTGTTACCACTGGGGGAAACTGG - Intronic
909078442 1:71081028-71081050 ATGTCTTCACAGGAGGAAAACGG + Exonic
910486796 1:87723785-87723807 GAGACATCACAGAAGGAAAATGG + Intergenic
910623292 1:89279423-89279445 GTGTCCTGACATGAGGAAAAAGG - Intergenic
911418493 1:97607751-97607773 TTGTTATCACAGAAGAAAACTGG + Intronic
912194564 1:107382159-107382181 TTGTTATCAAAGAAGGAAGAAGG + Intronic
912343401 1:108940532-108940554 ATGTCACCACTGGAGGAAAATGG + Intronic
912621187 1:111160019-111160041 CTTTTACCACAGGAGAAAAAAGG + Intronic
913218893 1:116643712-116643734 GTGTTGTCACAGGTGTAGAAAGG + Intronic
915062371 1:153196900-153196922 ATGGTGTCACAGGAGGAAAAAGG + Intergenic
915677439 1:157544749-157544771 GAGATAGAACAGGAGGAAAAGGG - Intronic
915926773 1:160027688-160027710 GTGTTATTAAAGGATTAAAAAGG + Exonic
915959660 1:160254832-160254854 GTGTTATGAAAGAAAGAAAAGGG + Intronic
916922878 1:169486996-169487018 TTGCTACCACAGGAGGAAAACGG - Intergenic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
918196891 1:182231198-182231220 ATGTTACCACGGGAGGAAACTGG + Intergenic
921477158 1:215625713-215625735 GTGATAACCCAGGAGGAAATGGG + Exonic
921750168 1:218783037-218783059 GTGTTTACACAGGTGGAAATAGG + Intergenic
922668397 1:227491517-227491539 CTGTTCTCAGAGCAGGAAAATGG - Intergenic
922708818 1:227810710-227810732 CTGATATCACAGAAGTAAAAAGG + Intergenic
923261783 1:232274594-232274616 GTATTTTGACAGGAGGGAAAGGG - Intergenic
924243633 1:242061766-242061788 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic
924517504 1:244779087-244779109 TGGTTATCACAGCAGGAAGATGG + Intergenic
924787696 1:247214488-247214510 GAATTATCACAGGTGGAAAAGGG - Intergenic
1064496184 10:15912672-15912694 GTGTTATCACATGCGGAAAGGGG - Intergenic
1064880327 10:20044823-20044845 GTGTAATAACATGAGCAAAATGG + Intronic
1065223937 10:23523822-23523844 ATGTTATCTCAAGAGGAGAAGGG - Intergenic
1065737682 10:28769294-28769316 ATGTTATTTCAAGAGGAAAAAGG + Intergenic
1065998882 10:31085880-31085902 TCTTTATCACTGGAGGAAAAAGG - Intergenic
1066658205 10:37713720-37713742 ATGTTATCACTGAAGGAAACTGG - Intergenic
1067042694 10:42963388-42963410 ATGTTATCACTGAAGGAAATTGG - Intergenic
1067664653 10:48266763-48266785 TTGTTATCACCAGAGGAAAGTGG - Intronic
1070941432 10:80351601-80351623 GTGCTGTCACAGAAGGCAAAGGG - Intronic
1072128584 10:92470005-92470027 GTGCAATCATAGGAGGAAATGGG - Intronic
1073815834 10:107205550-107205572 GTGTTATTGGAGGATGAAAAAGG + Intergenic
1073923776 10:108489602-108489624 GTGATATCACACAAGGAAACTGG - Intergenic
1074385544 10:113014066-113014088 GAGTTAACACAGGAGGACAGGGG + Intronic
1075603119 10:123785356-123785378 GTGTGTTCAGAGGAGGAAACCGG - Intronic
1076326408 10:129626716-129626738 GTGTTATCAGAGGCAGAAAATGG - Intronic
1076605214 10:131685057-131685079 GTGTTATCACAGACGCAGAAGGG + Intergenic
1077892440 11:6429201-6429223 GTGTTCTCACATGGTGAAAAAGG - Intergenic
1078315507 11:10290157-10290179 CTCTTCTCACAGCAGGAAAAGGG - Intronic
1078549958 11:12273200-12273222 GAGTTTTCTCAGCAGGAAAATGG + Intergenic
1079282122 11:19097015-19097037 GTGTTATCATATTTGGAAAAAGG - Intergenic
1080817114 11:35769238-35769260 GAGTGATCACAGACGGAAAATGG - Intronic
1080981435 11:37411741-37411763 GTGTTATCACAGGATTAGGAAGG - Intergenic
1081602514 11:44505168-44505190 GTGTCATTATAAGAGGAAAAGGG - Intergenic
1081744535 11:45463640-45463662 GTGTTATCACCGGAGCACAAGGG - Intergenic
1082647096 11:55740714-55740736 ATGTTATCAGAGGCTGAAAAGGG - Intergenic
1082793868 11:57366064-57366086 GTGAAATCACAGGAGTGAAAGGG - Intronic
1082845259 11:57719914-57719936 GGGTTATCAAAGGTGGCAAAAGG - Intronic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1085805222 11:79629717-79629739 TTGTGATCTCAGGAGGAGAAGGG + Intergenic
1085894570 11:80623238-80623260 GTGTTATAATTGGAAGAAAAAGG - Intergenic
1086025636 11:82287359-82287381 ATGTAATCACAAGTGGAAAAGGG - Intergenic
1086729763 11:90233971-90233993 GTGTAATCAGAGAAGGAACAGGG + Intergenic
1086930003 11:92682740-92682762 GTGTTCTGAGAGGAGGACAAGGG + Intronic
1087009939 11:93503505-93503527 ATGTTATCTTAGGTGGAAAATGG + Intronic
1087848139 11:102996467-102996489 GTGCCATCACAGCAGGAAATGGG + Intergenic
1088969330 11:114758496-114758518 GTTTGATCACAGGAGGAGACTGG + Intergenic
1089266497 11:117266714-117266736 GTGGAGTCCCAGGAGGAAAAAGG - Intronic
1089294523 11:117459682-117459704 GAGTTGTAAGAGGAGGAAAAGGG + Intronic
1090167496 11:124565760-124565782 ATGTTACCACTGAAGGAAAATGG + Intergenic
1090992675 11:131833830-131833852 GAGTTGTTACAGGAAGAAAAAGG - Intronic
1090994866 11:131856959-131856981 TTTTTATCAAAGGAGAAAAAAGG - Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091369967 11:135049593-135049615 CTGATATCACAGGAGGAAACAGG + Intergenic
1091761297 12:3088920-3088942 GTGGAATGACAGGATGAAAAGGG + Intronic
1095170753 12:39033183-39033205 GTGTTATTACAAGAGTCAAAAGG + Intergenic
1097769046 12:63559113-63559135 GTGTAAGCACAGGATAAAAAAGG - Exonic
1098527201 12:71499723-71499745 CTGTTACCCCAGGAGGAAGAGGG + Intronic
1098620964 12:72597901-72597923 GTCATAACTCAGGAGGAAAAAGG + Intronic
1099274469 12:80557722-80557744 ATGTTACCACTGGAAGAAAATGG - Intronic
1100037273 12:90267937-90267959 TTCTTACCACAGGGGGAAAAGGG - Intergenic
1100141582 12:91625545-91625567 GTGTTTTTACAGCTGGAAAATGG - Intergenic
1101337815 12:103811763-103811785 GTGTTAACACTGGAGGAAACTGG + Intronic
1101913241 12:108876750-108876772 TTGTTATGACTGGAGGAACAGGG - Intronic
1104956872 12:132471038-132471060 GTTATTCCACAGGAGGAAAAGGG + Intergenic
1105266057 13:18816578-18816600 GTGTTAACACAGAAAGGAAATGG - Intergenic
1107458683 13:40579455-40579477 GAGTTATGACAGGAGAAGAATGG + Intronic
1108503220 13:51086643-51086665 TTGTTATCAGAGGAGAAAAGTGG + Intergenic
1109172144 13:59109817-59109839 GTGTGGTCACAGGATGAAAAAGG - Intergenic
1110061800 13:71050130-71050152 GTCTTAGCACATCAGGAAAAGGG + Intergenic
1111856937 13:93649795-93649817 CTATTATTACTGGAGGAAAAGGG + Intronic
1111962649 13:94828057-94828079 CTGATATCACCTGAGGAAAAAGG + Intergenic
1112001508 13:95213928-95213950 CTGTAATCAAAGGAGGGAAATGG + Intronic
1112248080 13:97752837-97752859 GTGTCTTCACAGGGTGAAAAGGG - Intergenic
1112313179 13:98337930-98337952 ACCTTATCACATGAGGAAAATGG - Intronic
1112366694 13:98761474-98761496 GTGCCATAAGAGGAGGAAAACGG + Intergenic
1115554853 14:34536944-34536966 ATGTTAACACTGGAGGAAACTGG + Intronic
1115890334 14:38019413-38019435 GTGTTATCACAGAAGATAATGGG - Intronic
1116297583 14:43133188-43133210 GTGTTACCTCAGGTGGAAAAGGG + Intergenic
1117231071 14:53719288-53719310 GTGTGATCAGAGGAGGAGAAAGG + Intergenic
1121915400 14:97833158-97833180 CTCACATCACAGGAGGAAAAGGG - Intergenic
1202832452 14_GL000009v2_random:51519-51541 GTGTTAACACAGAAAGGAAATGG + Intergenic
1125843140 15:42824421-42824443 GTATTATCACTGGAGGAAGCTGG + Intronic
1128409908 15:67385420-67385442 GTGTTTTCATAAGAAGAAAAAGG + Intronic
1128464215 15:67895928-67895950 GTCTTATCACAGGAGTAAAGAGG - Intergenic
1128761268 15:70217600-70217622 GTGGCATCCCAGGAGGATAAAGG - Intergenic
1130174431 15:81553534-81553556 GAGTGATCATAGGAGTAAAAGGG + Intergenic
1130419741 15:83733102-83733124 GTGTAATCACAAGAGTGAAATGG + Intronic
1130679139 15:85981144-85981166 ACGTTATTGCAGGAGGAAAAAGG + Intergenic
1130772101 15:86934930-86934952 GTGTGATATCAGGAGGAGAATGG - Intronic
1131130344 15:89895135-89895157 GTGTTATTACAGGGGAAAATGGG + Exonic
1132151646 15:99466328-99466350 GTGTTACCACTGGGGGAAACTGG + Intergenic
1133524336 16:6589580-6589602 GTGTTATCCCAGGAGCAATCTGG + Intronic
1134081079 16:11325436-11325458 GTGTTTCCACTGGTGGAAAATGG + Intronic
1138277674 16:55747900-55747922 GTGTTAGAGCAGGAGGAAACTGG - Intergenic
1139227678 16:65248958-65248980 CTGTCATCACAGGTAGAAAAGGG + Intergenic
1142434184 16:90046774-90046796 GTATTTTCAGAGGAGGAAACGGG + Intergenic
1142511147 17:394273-394295 GAGTTCTCAAAGGAGGAAGAGGG + Intergenic
1146359398 17:32161409-32161431 ATGTTATCACAGGAGTAACTGGG + Intronic
1148601300 17:48896015-48896037 ATGTTCTCCCAGGAGGAATATGG + Intergenic
1153695275 18:7633988-7634010 GTGTTTTCCCAGGTGAAAAATGG - Intronic
1154422348 18:14244908-14244930 GTGTTAACACAGAAAGGAAATGG + Intergenic
1155140617 18:23041046-23041068 ATGTTACCACTGGAGGAAATGGG - Intergenic
1156388377 18:36626916-36626938 CTGTTATCCCAGGAGGAGGAGGG + Intronic
1156674755 18:39514207-39514229 TTGTTATCACAGAAGAAAAATGG + Intergenic
1156744194 18:40369466-40369488 CTCTATTCACAGGAGGAAAAAGG + Intergenic
1159137370 18:64352055-64352077 GTGTCTTCACATGAGGGAAAGGG - Intergenic
1161439142 19:4280443-4280465 GTGTGATCACAGGAGGGGACTGG + Intronic
1163599753 19:18241857-18241879 TTGTTTTCCCAGCAGGAAAATGG - Intronic
1164088618 19:21927933-21927955 TTCTGATCACAGGAGGAAATGGG + Intergenic
1168223458 19:54977738-54977760 GTGTTATCCCTGGAGAAAAAGGG - Exonic
1168689955 19:58370353-58370375 GTGTGATCACAAGAGGCAGAAGG - Intronic
1202640233 1_KI270706v1_random:76215-76237 GTGTTAACACAGAAAGGAAATGG - Intergenic
925751255 2:7091810-7091832 GTGTTATCACAGAACCAGAAAGG - Intergenic
926912271 2:17862221-17862243 GTGTTCTCTCAGGAGAAAAGAGG + Intergenic
927243809 2:20941003-20941025 GTGTTCTCACTGGGAGAAAAGGG + Intergenic
930517922 2:52431757-52431779 GTTTTGTCTCAGGAGGAAGATGG + Intergenic
931153117 2:59597233-59597255 GTGTTATCACAGGGGTTAGATGG - Intergenic
931428348 2:62191039-62191061 GTATTATAACAGGAGGAAGGAGG - Intergenic
932736547 2:74258666-74258688 GTGTTCTCTCATGAGTAAAATGG + Intronic
932760396 2:74435943-74435965 GGCTTATTACAGAAGGAAAACGG - Intronic
933588178 2:84202290-84202312 CTGTTCTCAAAGGAGGCAAAAGG + Intergenic
933936053 2:87204614-87204636 GTTTTGTCTCAGGAGGAAGATGG - Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
935097938 2:99964861-99964883 ATATTAGCACTGGAGGAAAATGG + Intronic
935312015 2:101793600-101793622 GTTTCATCTCAGGAGCAAAAAGG + Intronic
935377853 2:102418723-102418745 GGATTATAACTGGAGGAAAAAGG - Exonic
935399251 2:102643265-102643287 GTGGTGTCAGAGAAGGAAAAGGG - Intronic
936357095 2:111761215-111761237 GTTTTGTCTCAGGAGGAAGATGG + Intergenic
938506735 2:131892450-131892472 TAGATATCACAGGGGGAAAAAGG - Intergenic
938748697 2:134307527-134307549 CTGTTATCACAGCAGGAAACCGG - Intronic
939060529 2:137416354-137416376 GTCCCATGACAGGAGGAAAAAGG - Intronic
939115004 2:138050418-138050440 GTGTTCTCACATGATGAAAGGGG + Intergenic
940275324 2:151934151-151934173 GTGTGATCACAGGGGACAAAAGG + Intronic
940613333 2:156019039-156019061 ATGGTATCAAATGAGGAAAAAGG + Intergenic
941064938 2:160891321-160891343 CTATTACTACAGGAGGAAAATGG + Intergenic
942571724 2:177322303-177322325 GAGTTATCAAGGTAGGAAAATGG - Intronic
943045890 2:182862038-182862060 GTGTGATATGAGGAGGAAAATGG - Intronic
943096994 2:183441379-183441401 GTGTTATCACTGTAGGCAACTGG + Intergenic
943618032 2:190116126-190116148 GTGATATCACAGGAAAAAAGGGG + Intronic
943941139 2:193999457-193999479 GTTTAATCACAGGGGGAAACTGG - Intergenic
944007472 2:194927673-194927695 GTGTTCTCACAGGATGGAAGCGG + Intergenic
944210799 2:197204907-197204929 GTGTTATCAGAGAAGCAGAATGG + Intronic
944850353 2:203713058-203713080 GTGTTGTCTCAGGAAGGAAAAGG + Intronic
947366513 2:229401733-229401755 ATGTTATCATTGGAGGAAACTGG + Intronic
947967414 2:234293024-234293046 GTGTTATCACTGGGGGAAACTGG - Intergenic
948500786 2:238392255-238392277 ATGTTATCACTGGGGGAAAGTGG - Intronic
1168969741 20:1922866-1922888 TTTATATCACAGGAGGAAAGAGG + Intronic
1169051928 20:2586325-2586347 GTGTTCAAACAGGAGAAAAATGG + Intronic
1169946038 20:10990007-10990029 GTCATGTAACAGGAGGAAAAAGG + Intergenic
1171497908 20:25570095-25570117 GTTTTAACACAGGAGGCAGAGGG + Intronic
1171887110 20:30662874-30662896 GTGTTAACACAGAAAGGAAATGG - Intergenic
1173739185 20:45384763-45384785 GTGTTACCTCTGGAGGAAACTGG - Intronic
1174731035 20:52917928-52917950 GTGCTATCACTGGAGAAAAGGGG - Intergenic
1175357311 20:58378752-58378774 GTGTTTCCAAAGGAGGAAAAGGG + Intergenic
1175742593 20:61430443-61430465 GTGTAATTGCAGGAGGAAATGGG + Intronic
1176648559 21:9373801-9373823 GTGTTAACACAGAAAGGAAATGG - Intergenic
1176786902 21:13267889-13267911 TAGATATCACAGGGGGAAAAAGG + Intergenic
1176851125 21:13915041-13915063 GTGTTAACACAGAAAGGAAATGG - Intergenic
1177770210 21:25505499-25505521 GTGGTGGCATAGGAGGAAAATGG - Intergenic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1179164281 21:38923881-38923903 GTGTCATCACTGGTGTAAAATGG - Intergenic
1179433299 21:41340474-41340496 CTGTTATCACAGGAGTGAATGGG - Intronic
1179494181 21:41761258-41761280 GTGTTCCCAGAGGAGGAGAAAGG - Intronic
1180361710 22:11905681-11905703 GTGTTAACACAGAAAGGAAATGG + Intergenic
1180820191 22:18821767-18821789 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1180988264 22:19918207-19918229 GTATCTTCACAGGAGGAAGATGG - Exonic
1181206414 22:21256239-21256261 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1182283830 22:29232544-29232566 CTGTAACCACAGGAGGACAACGG - Intronic
1182310255 22:29399690-29399712 GTGTTATCACAGGAGGAAAACGG - Intronic
1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG + Intergenic
1184082315 22:42231579-42231601 GTGTTATTACAAGAGTCAAAAGG + Intronic
1184298433 22:43540856-43540878 GTCTTCTCACAAGATGAAAAGGG + Intronic
1203220506 22_KI270731v1_random:39184-39206 GTGTTGTCACAGGTGTAGAAAGG - Intergenic
1203270318 22_KI270734v1_random:47638-47660 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
949157556 3:847594-847616 GTTTTGTCTCGGGAGGAAAATGG + Intergenic
951284977 3:20799694-20799716 GTGTTTTCATAGGAGTTAAATGG + Intergenic
951320267 3:21235983-21236005 GTGTCATCACATGGTGAAAAGGG - Intergenic
951366922 3:21794598-21794620 GTGTTCTCACAGGATGGAAGGGG + Intronic
951937818 3:28041547-28041569 ATCTTATTACAGGTGGAAAATGG - Intergenic
952375382 3:32762903-32762925 GAATTATGACAGGAGGGAAATGG - Intronic
952954662 3:38549575-38549597 GTGAAAACACAGGGGGAAAATGG + Exonic
953277982 3:41522842-41522864 GTGTTATCACAAGAGGAACTGGG + Intronic
953452044 3:43013732-43013754 GTGATATCACAGGAAGGAACTGG + Intronic
953584413 3:44186802-44186824 TAGATATCACAGTAGGAAAATGG + Intergenic
953874712 3:46660070-46660092 GTGTGGTCACAGCAGGAAGAGGG - Intergenic
956710835 3:72037363-72037385 GTGTTACCACTGGGGGAAATTGG - Intergenic
957568877 3:81920131-81920153 GTGTTTTCTCAGGAAGGAAAAGG - Intergenic
958598670 3:96264670-96264692 GTGTTATTACAAGAGTCAAAAGG + Intergenic
958731054 3:97960965-97960987 TTGCTATCAAAGGAGAAAAAGGG + Intronic
959390522 3:105767462-105767484 TGGTTACCACAGGGGGAAAATGG - Intronic
960039510 3:113135525-113135547 GTGGTACCATAGAAGGAAAATGG + Intergenic
964680050 3:159328541-159328563 GTTTTACCTCAGGTGGAAAAGGG + Intronic
964739272 3:159948550-159948572 GGGTTATCATGGGAGGGAAACGG + Intergenic
964953999 3:162329674-162329696 GTGTCATCACATGATGCAAAAGG + Intergenic
965704180 3:171489450-171489472 ATGTTCTCAGAGGAAGAAAAAGG + Intergenic
965715600 3:171599252-171599274 GTGTGAGCACAGGAGGCAGAGGG - Intergenic
966235193 3:177693243-177693265 GTGTTACTACAAGAGTAAAAAGG - Intergenic
1202738322 3_GL000221v1_random:31185-31207 GTGTTAACACAGAAAGGAAATGG + Intergenic
969069045 4:4517422-4517444 GTTTTCACACAGAAGGAAAAGGG + Intronic
970403776 4:15742758-15742780 CTGTTATCACTGAAGGAAACTGG + Intergenic
971515331 4:27479145-27479167 GTGTTCTCACATGAGGGAAGGGG - Intergenic
972553317 4:40154637-40154659 GTGGTATTAAAAGAGGAAAAAGG + Exonic
972810327 4:42578180-42578202 TTGATATCTCAGGAGAAAAAAGG - Intronic
972858931 4:43142803-43142825 GGGTACACACAGGAGGAAAATGG + Intergenic
973370468 4:49242563-49242585 GTGTTAACACAGAAAGGAAATGG - Intergenic
973390556 4:49552853-49552875 GTGTTAACACAGAAAGGAAATGG + Intergenic
974708245 4:65552044-65552066 GTGCTATCACTTGAGGAAACAGG - Intronic
975970067 4:80023247-80023269 GTTTTATAACAGGAAGAATATGG - Intronic
976417965 4:84801230-84801252 GTGTAACTACTGGAGGAAAATGG + Intronic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
976863903 4:89700954-89700976 GTGTTACCACTAGAGGAAACTGG - Intergenic
976938036 4:90664371-90664393 GTGTTCTCACAGGATAAACAAGG + Intronic
977421057 4:96800178-96800200 ATGTTATCATTGGAGGAAACTGG + Intergenic
979234984 4:118389681-118389703 GTGTTGTGACAGGAGGGAAGGGG + Intergenic
979960519 4:127015337-127015359 GTGTTTTCTCAGGAGGACACAGG - Intergenic
980446025 4:132908816-132908838 GTGTTCTCACAAGAGCAATAGGG - Intergenic
981724577 4:147834145-147834167 GGGTTATCACAGGAGTAGACTGG - Intronic
982394964 4:154906444-154906466 GTGTTATCACAATAGTCAAAAGG - Intergenic
982805928 4:159762401-159762423 ATGTTACCACTGGAGAAAAATGG - Intergenic
983297600 4:165885715-165885737 GTTTTTTCACAGGAAAAAAATGG + Intronic
983806751 4:172002831-172002853 GTGTTATAAGAGGTGGAGAATGG + Intronic
984610211 4:181828912-181828934 GTGGTATCATGGGAGGACAATGG - Intergenic
984649960 4:182260399-182260421 TAGTTAACACAGTAGGAAAAAGG - Intronic
985124393 4:186677777-186677799 GAATTAAAACAGGAGGAAAACGG + Intronic
985241459 4:187934985-187935007 GTGTTATTACTGCAGGGAAAAGG - Intergenic
1202767594 4_GL000008v2_random:162073-162095 GTGTTAACACAGAAAGGAAATGG - Intergenic
987192741 5:15495933-15495955 ATGTTACCACTGGAGGAAACTGG - Intergenic
988699920 5:33663109-33663131 GTGTTTTCACAAAAGGAAACTGG - Intronic
989100988 5:37822585-37822607 GTCTTCAGACAGGAGGAAAATGG + Intronic
991105381 5:62836930-62836952 ATGTTACCACTGGAGGAAACTGG + Intergenic
991237349 5:64415124-64415146 GTATCATCACAGGAAGAAGAAGG - Intergenic
991360319 5:65813205-65813227 GTGTTATTTCAGGAGGAAGATGG - Intronic
991646007 5:68801012-68801034 GAGTTGTCAATGGAGGAAAAGGG - Intergenic
992158277 5:73975861-73975883 ATGTTAATACATGAGGAAAACGG - Intergenic
993074360 5:83209430-83209452 CTGTTATCACAGCATGAAAATGG - Intronic
993631752 5:90294160-90294182 GTGTGATGACAGGAGTAGAATGG + Intergenic
993922899 5:93829222-93829244 GTGTCTTCTCAGGGGGAAAAGGG - Intronic
994131177 5:96229893-96229915 GTTTTATAACAGAAGGAACACGG - Intergenic
995216055 5:109595812-109595834 GTGTTTTCACATAAGGTAAAAGG + Intergenic
995585447 5:113643620-113643642 GTGTGAGGACAGGAGTAAAAGGG + Intergenic
996187355 5:120493540-120493562 ATGTTACCACTGGAGGAAATTGG - Intronic
998293005 5:140934966-140934988 GTGTTATCACTGGGGAAAAGTGG - Intronic
998570125 5:143249643-143249665 GTGTTAACAGAGCAGGAAGAGGG - Intergenic
998761856 5:145440878-145440900 TTGTGACCACAGGAGGAACATGG - Intergenic
998964049 5:147519471-147519493 GTGTTGTCACAAGAGGAAAAGGG + Intergenic
999072932 5:148766847-148766869 GTGTTACCACAGGAGTAAGAAGG - Intergenic
999646157 5:153718872-153718894 GTGTTATGACTGGAGGATATTGG + Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
1001569043 5:172718233-172718255 GTGTCATGAAAGGAGGAAACAGG - Intergenic
1002598325 5:180338761-180338783 TTTTTGTCACAGGAGGAAGAAGG - Intronic
1003698555 6:8437394-8437416 TGGTTATCACAGGAGTAAATGGG - Intergenic
1004461014 6:15836062-15836084 GTGTTCACAGAGAAGGAAAAGGG - Intergenic
1004778107 6:18871754-18871776 GTGTTATCACAATAGCCAAAAGG - Intergenic
1004968351 6:20879944-20879966 GTCTTCTCACAGGAAGACAAGGG - Intronic
1005563625 6:27066940-27066962 GTGTTCTCACAGGAGAACAAAGG - Intergenic
1005815971 6:29553301-29553323 GAGGTAGCACAGGAGGACAAGGG - Intergenic
1006015625 6:31078536-31078558 GTGTCAGCACTGGAGGAAGAAGG + Intergenic
1006263761 6:32898106-32898128 GTGTTACCCCAGTAGGAAAATGG - Intergenic
1007296421 6:40825304-40825326 GTGTTAACACAGCAGGGAACTGG - Intergenic
1010397638 6:75410039-75410061 GTGGTATTGCAGGAGAAAAATGG - Intronic
1012120669 6:95362683-95362705 GTGTTTACACAAGAAGAAAATGG + Intergenic
1012222421 6:96664955-96664977 CTGTAATCACATGTGGAAAATGG + Intergenic
1012392054 6:98752879-98752901 GTGTTATCACAGGAGGTCTAAGG - Intergenic
1012409715 6:98943149-98943171 GTGTTACCATAGGTGGAAACTGG + Intronic
1013129426 6:107217823-107217845 GAGAAGTCACAGGAGGAAAAAGG + Intronic
1013632149 6:111996097-111996119 GTGTTATAGCAGGAGGGACATGG - Intergenic
1015424858 6:133053721-133053743 GTTTAATCAAAGGAGGGAAATGG + Intergenic
1015521222 6:134133381-134133403 GTGTTATTTAAGGAGGAAAGAGG + Intergenic
1016098359 6:140065962-140065984 GTGTAATCATAGGAGGACAAAGG + Intergenic
1016596145 6:145803645-145803667 AGGGTATCACAGAAGGAAAATGG + Intronic
1017559725 6:155614502-155614524 GAGTAAACAGAGGAGGAAAAAGG + Intergenic
1017991138 6:159490825-159490847 TTGTTGTGATAGGAGGAAAAGGG + Intergenic
1018255200 6:161911619-161911641 TTATTGTCACTGGAGGAAAATGG + Intronic
1019425105 7:971379-971401 ATTTTAGCACAGAAGGAAAAAGG + Intronic
1019957042 7:4423891-4423913 GTGTTGTTAGAGGAGGTAAAGGG - Intergenic
1020269846 7:6588382-6588404 GTGTTCACACTGAAGGAAAAGGG - Intronic
1020475465 7:8589028-8589050 TTATTATCAGTGGAGGAAAAAGG + Intronic
1020950685 7:14672740-14672762 GTATTTTGACAGAAGGAAAAAGG + Intronic
1021229406 7:18067613-18067635 GTGTAATCAAAGGTGTAAAAAGG + Intergenic
1022470139 7:30677007-30677029 GTGGTTCCACAGAAGGAAAATGG + Intronic
1022614610 7:31916521-31916543 CTGTTCTCACACCAGGAAAATGG - Intronic
1022928325 7:35080186-35080208 GTGTAAGCACAGGATAAAAAAGG - Intergenic
1023254902 7:38303533-38303555 GTGTTAGGAAAGGAGGTAAATGG + Intergenic
1023648834 7:42347551-42347573 GTATTATCACAGCAGGAGGAGGG + Intergenic
1024644136 7:51357080-51357102 GAGTTAGCACAGGCGGCAAAAGG - Intergenic
1027349302 7:77294127-77294149 GTGGAACCAGAGGAGGAAAATGG - Intronic
1028373955 7:90125378-90125400 GTGTAAGCACAGGATAAAAAAGG + Intergenic
1028934232 7:96447739-96447761 GTCTTATTAGAGGAGGAAGAGGG + Intergenic
1029877208 7:103766861-103766883 GTTTTATGTCAGGAGGAAAGAGG - Intronic
1030576765 7:111297301-111297323 ATGTTATCACTGGAGAAAACTGG + Intronic
1030655161 7:112159528-112159550 GTGTTTTGACAGGAGGAAGTAGG - Intronic
1030721552 7:112876998-112877020 GTGTTATAAATGGAGTAAAAGGG - Intronic
1031773815 7:125881257-125881279 TTTTTATCACATGAGAAAAATGG + Intergenic
1031932370 7:127698859-127698881 TTGGTATCTGAGGAGGAAAAGGG - Exonic
1032710178 7:134454344-134454366 GTGTTATCAAAGGAGGAACTAGG - Intronic
1034819660 7:154205233-154205255 GTGTTACCACTGGAGGAAACTGG - Intronic
1034922976 7:155098950-155098972 GTGTTCCCACAGGAGGAAATGGG + Intergenic
1036064200 8:5359373-5359395 GGGTTGTCATAGGAGGAACAAGG + Intergenic
1037231435 8:16663620-16663642 GTGTGATCACAGGAAGACAGCGG + Intergenic
1038121925 8:24626725-24626747 GTGTTTTCACATGATTAAAATGG - Intergenic
1038160063 8:25028049-25028071 GTGTCAGCACATGGGGAAAATGG + Intergenic
1038868690 8:31468647-31468669 GTGTTATTACAAGAGTAAAAAGG + Intergenic
1039099311 8:33923778-33923800 GAATTATCACTGGAGGAAACTGG - Intergenic
1039298965 8:36188808-36188830 GTGGTTGCCCAGGAGGAAAATGG - Intergenic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1041253683 8:55960239-55960261 ATGTTACCACTGGAGGAAACTGG - Intronic
1041508665 8:58630245-58630267 GTGTCTTCACAGGAGGAAGGAGG + Intronic
1043432343 8:80207188-80207210 CTGTTTTCACAGGAGGCCAAGGG - Intronic
1043629135 8:82306612-82306634 CTGTTATTACAGGTAGAAAATGG - Intergenic
1044458086 8:92412287-92412309 GTGTTAGGAGAGGAGGAACATGG - Intergenic
1044488346 8:92780924-92780946 TTGTTACCAAGGGAGGAAAATGG + Intergenic
1045999905 8:108407312-108407334 GAGTAATCTCAGAAGGAAAAAGG - Intronic
1046502965 8:115102075-115102097 GTGTTAGCACAGGAAGAAAATGG + Intergenic
1046740428 8:117821884-117821906 GTCTAATCACAGTAGGGAAAAGG - Intronic
1048197488 8:132344111-132344133 GAGATATCTAAGGAGGAAAAGGG + Intronic
1048733241 8:137467907-137467929 GAGATACCATAGGAGGAAAAGGG - Intergenic
1050937986 9:11423405-11423427 ATATCATCACAGGAGGAACATGG + Intergenic
1052712127 9:32069810-32069832 GTGTTACCAGAGGTGGAAAGGGG - Intergenic
1052843744 9:33316143-33316165 GTTTTATCCCAGGCTGAAAATGG + Intronic
1052876311 9:33569017-33569039 GTGTTAACACAGAAAGGAAATGG + Intronic
1053499704 9:38575333-38575355 GTGTTAACACAGAAAGGAAATGG - Intronic
1053661415 9:40284734-40284756 GTGTTAACACAGAAAGGAAATGG + Intronic
1053911792 9:42914077-42914099 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054373537 9:64430952-64430974 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054523194 9:66091550-66091572 GTGTTAACACAGAAAGGAAATGG - Intergenic
1055978900 9:81981379-81981401 ATGTTACCACTGGAGGAAAATGG - Intergenic
1056911590 9:90706100-90706122 AAATAATCACAGGAGGAAAAAGG + Intergenic
1057521350 9:95762938-95762960 GTCCCATCACAGGAGGAAAAAGG + Intergenic
1058144264 9:101394272-101394294 GTGTTATCCCAGGAGCAATTTGG - Intronic
1058523832 9:105837867-105837889 GCGTCATCACTGGAGGAGAAAGG - Intergenic
1059222398 9:112636956-112636978 AAGTTAACAGAGGAGGAAAATGG - Intronic
1059676140 9:116541922-116541944 ATGTTACCACAGGAGAAAACTGG - Intronic
1060001674 9:119964359-119964381 ATGTTAAGACAGCAGGAAAATGG - Intergenic
1203692007 Un_GL000214v1:51026-51048 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203707052 Un_KI270742v1:61630-61652 GTGTTAACACAGAAAGGAAATGG + Intergenic
1203548350 Un_KI270743v1:146945-146967 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203644288 Un_KI270751v1:53165-53187 GTGTTAACACAGAAAGGAAATGG + Intergenic
1186123198 X:6384801-6384823 GTGAAATCACAGGAGAAAGAGGG - Intergenic
1186188854 X:7049434-7049456 GTGTTCTTAAAGGAGGCAAATGG + Intronic
1186257648 X:7740076-7740098 GTGTGTTCTCTGGAGGAAAAGGG - Intergenic
1186594518 X:10966352-10966374 ATGTTATTACATGGGGAAAATGG + Intergenic
1188758645 X:33997608-33997630 GTGTTCTCACATGGTGAAAAGGG - Intergenic
1188790204 X:34399322-34399344 GTGGTAATAGAGGAGGAAAATGG + Intergenic
1188818003 X:34739197-34739219 GTGAAAACAGAGGAGGAAAAAGG + Intergenic
1188875952 X:35430409-35430431 CTGTTAACACAGGAAGAAAAGGG + Intergenic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189005415 X:36988890-36988912 TTGTGCTCACAAGAGGAAAAGGG - Intergenic
1189043612 X:37569052-37569074 TTGTGCTCACAAGAGGAAAAGGG + Intronic
1189913253 X:45832258-45832280 ATATTTTCAAAGGAGGAAAATGG - Intergenic
1194924856 X:99812156-99812178 GTCTTACAAAAGGAGGAAAAAGG - Intergenic
1195756968 X:108208661-108208683 GTGAAATCACAAGAGAAAAATGG + Intronic
1196163559 X:112513316-112513338 GTGATGTAACAGGAGGAAAATGG + Intergenic
1196333580 X:114502217-114502239 TTGTTATGACAGTAGAAAAATGG - Intergenic
1197095356 X:122587943-122587965 GTGTAATCAAAGGAGAATAATGG + Intergenic
1197168676 X:123407522-123407544 GTGTTCTCACATGATGGAAAGGG + Intronic
1200787021 Y:7269837-7269859 GTTTTATCAGATGAGGAAATGGG + Intergenic
1200911656 Y:8536558-8536580 GTATTGTCTCAGGAGAAAAATGG + Intergenic
1200925082 Y:8647122-8647144 GTCTTGTCTCAGGAGAAAAATGG + Intergenic
1201758564 Y:17515301-17515323 CTGTTCTCAGAGCAGGAAAAGGG - Intergenic
1201842991 Y:18390689-18390711 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic
1201903835 Y:19069464-19069486 TTGTAATCACAAGAGGAAGAGGG + Intergenic
1202272854 Y:23087275-23087297 GTGTCATGCCAGGAGGACAAAGG + Intergenic
1202293172 Y:23333407-23333429 GTGTCATGCCAGGAGGACAAAGG - Intergenic
1202425851 Y:24721019-24721041 GTGTCATGCCAGGAGGACAAAGG + Intergenic
1202444938 Y:24949067-24949089 GTGTCATGCCAGGAGGACAAAGG - Intergenic