ID: 1182690977

View in Genome Browser
Species Human (GRCh38)
Location 22:32162335-32162357
Sequence GTGTTATCACAGGAGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690968_1182690977 10 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG No data
1182690973_1182690977 -2 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG No data
1182690966_1182690977 17 Left 1182690966 22:32162295-32162317 CCTGTGACCACAAAAGAGACCAT No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG No data
1182690965_1182690977 18 Left 1182690965 22:32162294-32162316 CCCTGTGACCACAAAAGAGACCA No data
Right 1182690977 22:32162335-32162357 GTGTTATCACAGGAGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690977 Original CRISPR GTGTTATCACAGGAGGAAAA CGG Intergenic