ID: 1182690978

View in Genome Browser
Species Human (GRCh38)
Location 22:32162354-32162376
Sequence ACGGTTGCTTCAAAAAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 2, 1: 0, 2: 2, 3: 9, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690968_1182690978 29 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG 0: 2
1: 0
2: 2
3: 9
4: 115
1182690973_1182690978 17 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG 0: 2
1: 0
2: 2
3: 9
4: 115
1182690975_1182690978 5 Left 1182690975 22:32162326-32162348 CCACAGGGAGTGTTATCACAGGA 0: 2
1: 0
2: 0
3: 10
4: 132
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG 0: 2
1: 0
2: 2
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690978 Original CRISPR ACGGTTGCTTCAAAAAGCAG AGG Intergenic
907109775 1:51916539-51916561 ACAGTTGCTTCAGAGGGCAGTGG - Exonic
907138868 1:52165969-52165991 ACTGTTGCTTCAAAGAACAGAGG - Intronic
907358344 1:53894571-53894593 AGGGGTGCTTGAAATAGCAGTGG + Intronic
908074771 1:60503748-60503770 TCGGTTGTTTCCATAAGCAGGGG - Intergenic
908080655 1:60574507-60574529 CCTGTTGCTTCAAAATGCTGAGG - Intergenic
909519422 1:76549795-76549817 ACTGATGCTTCCACAAGCAGTGG + Intronic
913696403 1:121329988-121330010 GCGGTGGCTTCAAAAACCATGGG + Intronic
914141158 1:144950065-144950087 GCGGTGGCTTCAAAAACCATGGG - Intronic
916712343 1:167422877-167422899 AGACTTCCTTCAAAAAGCAGGGG - Exonic
918648891 1:186935114-186935136 AAGGATGCTTCAAGAAGGAGTGG + Intronic
920483729 1:206348354-206348376 GCGGTGGCTTCAAAAACCATGGG + Intronic
923145185 1:231192791-231192813 AAGGGGGCATCAAAAAGCAGTGG + Intronic
1066950778 10:42113343-42113365 GCGGTGGCGGCAAAAAGCAGCGG + Intergenic
1070196005 10:74157065-74157087 GCTGTTGCTTTAAAAAGCTGTGG + Intronic
1071050800 10:81446539-81446561 CAGATTGTTTCAAAAAGCAGAGG - Intergenic
1072418891 10:95272814-95272836 ACTGATGCTTCTAAAACCAGTGG + Intronic
1074924547 10:118054288-118054310 AAGGTTGCTTAAAATAACAGTGG + Intergenic
1077820361 11:5731734-5731756 ATGGTTGCTGAAAAAAGGAGGGG - Intronic
1081481416 11:43493049-43493071 ACAGATTCTTCAAGAAGCAGAGG - Intronic
1083502071 11:63118639-63118661 ACATTTGCTTCAAAAATAAGTGG + Intronic
1083570533 11:63759404-63759426 ACGGCAGCTGCAAAAAGTAGTGG + Exonic
1087553373 11:99681410-99681432 ACGGTTGCTGAACAACGCAGTGG - Intronic
1088624621 11:111720776-111720798 ACGCGAGTTTCAAAAAGCAGAGG - Intronic
1088729363 11:112667319-112667341 CAGGTTGTCTCAAAAAGCAGGGG - Intergenic
1090314570 11:125773869-125773891 ATGGTTGCTAGATAAAGCAGAGG + Intergenic
1091978417 12:4845525-4845547 ACGGTTCCTAGAAAAAACAGAGG + Intronic
1102907123 12:116685334-116685356 ACGTTTGTTTCACAAAGCAAAGG + Intergenic
1107346583 13:39467990-39468012 AGGGAAGCTTCAAAAAACAGAGG + Intronic
1108372295 13:49782201-49782223 AAGGTTGTTTCCAAAAGCAGGGG + Intronic
1108743551 13:53364840-53364862 ATGGTTGGTTAAAAAAGGAGGGG + Intergenic
1108992714 13:56682087-56682109 AAAGTTGCCTCTAAAAGCAGAGG - Intergenic
1109104018 13:58225442-58225464 ACAGTTGCTTGAAACACCAGTGG - Intergenic
1109881114 13:68477797-68477819 ACTTTTGTTCCAAAAAGCAGAGG + Intergenic
1110720634 13:78757600-78757622 ATTGATGCTTCAAAAAGCAAGGG + Intergenic
1111709858 13:91797312-91797334 ATTGTTGCTACAAAAAGTAGTGG + Intronic
1114702138 14:24689761-24689783 ATGGTTGCTTCTATAAGAAGGGG + Intergenic
1116330047 14:43584278-43584300 ATCGTTGCTTTAAACAGCAGGGG - Intergenic
1117023223 14:51593940-51593962 ACTTTTGCTTCAGAAAGTAGGGG - Intronic
1119868839 14:77995724-77995746 ACGGTGGCTTTAATAAACAGGGG + Intergenic
1124894960 15:33767740-33767762 GCAGTTGCTTCAGAAAGCAGTGG - Intronic
1129863069 15:78878239-78878261 ACCTTTGCTTCATAAAGAAGAGG - Exonic
1130539519 15:84812134-84812156 ACTGTTCCTTCAAAATACAGGGG - Intergenic
1132421177 15:101671142-101671164 ATGTTTTCTTGAAAAAGCAGGGG - Intronic
1135521228 16:23179994-23180016 ACTGATGCTTCAAGAAGGAGAGG + Intergenic
1135849338 16:25949019-25949041 ACACTTGCTCCAAAAAGCAGTGG - Intronic
1140807954 16:78551224-78551246 TAGGTTTCTTCAAAAATCAGTGG - Intronic
1140969221 16:79996884-79996906 AGGGTTTCTTCAACAATCAGGGG + Intergenic
1141820142 16:86440165-86440187 AGGGTTCCTTGACAAAGCAGCGG + Intergenic
1143488826 17:7271758-7271780 ACGTTAATTTCAAAAAGCAGAGG + Intergenic
1145388543 17:22436419-22436441 ACGGTCACTTCAAAAAGCTTTGG - Intergenic
1145840273 17:27988736-27988758 CTTGTTGCTTCAGAAAGCAGTGG - Intergenic
1146518794 17:33510345-33510367 AAGTTTTCTTGAAAAAGCAGAGG + Intronic
1147050959 17:37794531-37794553 ACGGCTGCTGCAAGAAACAGTGG + Intergenic
1147768435 17:42851933-42851955 ACTGTTGCTTCTACAAGCACCGG + Exonic
1151401105 17:73856683-73856705 ACGTTTGTTTCAAAATGTAGAGG - Intergenic
1154105897 18:11522641-11522663 AACGTTGGTTCAAAAAGAAGTGG - Intergenic
1155343744 18:24838446-24838468 ACTGTTGCTGCAAGAAGCAGGGG - Intergenic
1159338575 18:67103476-67103498 AAGGCTGCTTCTAAAGGCAGTGG + Intergenic
1159699642 18:71608918-71608940 AAGTTTTCTTCAAAAAGCAAAGG - Intergenic
1159939270 18:74394072-74394094 AAGATTGTTACAAAAAGCAGTGG - Intergenic
926680719 2:15661976-15661998 ATGGTTGGTTAAATAAGCAGTGG - Intergenic
927323809 2:21779731-21779753 ACAGTGGCTTCAACAAGTAGAGG - Intergenic
930151610 2:48065989-48066011 AGGGTTGCTGGAAAGAGCAGAGG + Intergenic
933486503 2:82931401-82931423 ACTGTCACTTCATAAAGCAGGGG - Intergenic
935790968 2:106589767-106589789 ACGGAGGCTTCAAAGAGGAGTGG + Intergenic
936980959 2:118264896-118264918 AAGGTAGCCTCATAAAGCAGTGG - Intergenic
938516285 2:132010321-132010343 GCGGTGGCTGCAAAAAGCAGCGG + Intergenic
939533179 2:143390844-143390866 AGGGTTGCTGTAAAAAGCGGAGG - Intronic
944882681 2:204029466-204029488 CTGGTTGATTCAAAAAGCAAGGG - Intergenic
945771274 2:214045489-214045511 ACTCTTGCTTGAGAAAGCAGAGG + Intronic
946178634 2:217937149-217937171 AGTGTTGCTGCAAAACGCAGTGG - Intronic
1171727156 20:28634912-28634934 ACGATTGTTTTAAAAAGTAGTGG + Intergenic
1172532274 20:35640682-35640704 ACTGTAACTTCAACAAGCAGAGG + Intronic
1174806651 20:53609210-53609232 ACTGTTTCTTAAAAAAGGAGGGG + Intronic
1182310254 22:29399671-29399693 ACGGTTGCTTCAAAAAGCAGAGG - Intronic
1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG + Intergenic
1184787340 22:46678273-46678295 ACGGTTGCTCCCTAAAGCACAGG - Exonic
955549257 3:60066021-60066043 ACAGTTGCTTAAAAAAATAGGGG - Intronic
959317815 3:104831361-104831383 CAAATTGCTTCAAAAAGCAGTGG - Intergenic
960804269 3:121567690-121567712 GTGGTTGCATCAAAAAGCACAGG + Intergenic
961514466 3:127424104-127424126 ACGGTTTGTTCAAATGGCAGTGG - Intergenic
966589378 3:181663926-181663948 ATGGTGTTTTCAAAAAGCAGGGG + Intergenic
969885582 4:10212414-10212436 ATGTTGGCCTCAAAAAGCAGAGG - Intergenic
970118440 4:12725697-12725719 AAGGTTGCTGCAAAAGGGAGAGG + Intergenic
975478964 4:74856734-74856756 AGGGCTGTTTCATAAAGCAGGGG + Intergenic
981329205 4:143488651-143488673 ACTTCTGCCTCAAAAAGCAGAGG + Intergenic
981412745 4:144452013-144452035 ATGATTTCTTTAAAAAGCAGAGG - Intergenic
981494628 4:145377491-145377513 ACGGCAGCTGCAAAAAGTAGTGG + Intergenic
982073056 4:151712549-151712571 ACTGTTTCTGCAAACAGCAGGGG + Intronic
984686263 4:182671812-182671834 ACTGTTAATTCAAAACGCAGAGG - Intronic
985710193 5:1423578-1423600 AGGGATCCTTCAAAAAACAGTGG - Intronic
986384229 5:7216187-7216209 ACTCTTGCTTAAATAAGCAGAGG - Intergenic
989372033 5:40720898-40720920 ACGGTGGCTACAAAAAGTACTGG + Intronic
992660484 5:78955330-78955352 ACTGCAGCTTTAAAAAGCAGTGG - Exonic
997908046 5:137840074-137840096 ACAGATGCTTGAAACAGCAGAGG + Intergenic
1001975868 5:175997846-175997868 AGGCTTGCTTTGAAAAGCAGAGG + Intronic
1002241557 5:177845926-177845948 AGGCTTGCTTTGAAAAGCAGAGG - Intergenic
1007940836 6:45779741-45779763 TAGGCTGCTACAAAAAGCAGCGG - Intergenic
1008810519 6:55492228-55492250 ACCTTTGCTTCAGGAAGCAGAGG - Intronic
1009427017 6:63525587-63525609 ACTGGTGCTTCAGAACGCAGAGG - Intronic
1010237314 6:73585936-73585958 ATGGTTGCTCTAAAAGGCAGAGG + Intergenic
1011881733 6:92036273-92036295 AAGGTAGCTGCAAAAAGTAGAGG + Intergenic
1012174794 6:96067538-96067560 GTGGTTGCTTGAAAAAGCAAAGG + Intronic
1015554917 6:134451518-134451540 AAAGTCCCTTCAAAAAGCAGGGG + Intergenic
1015963330 6:138672627-138672649 ACGTCTGTTTCAAAAAGAAGTGG - Intronic
1021049458 7:15965037-15965059 ACAGTAGTTTCAAAAAGCATAGG + Intergenic
1021837446 7:24693964-24693986 ACAGTTACTTCAAAAACTAGAGG - Exonic
1023839017 7:44085555-44085577 AAGGGTGCTTCAGCAAGCAGGGG - Intergenic
1025320280 7:58087654-58087676 ACGGTGGGGTCAAAAAGCCGGGG - Intergenic
1025478583 7:60956642-60956664 ACGGTGGGGTCAAAAAGCCGGGG - Intergenic
1025553477 7:62276047-62276069 ACGGTGGGGTCAAAAAGCCGGGG + Intergenic
1032048716 7:128632397-128632419 ACGGTTGCTTTAAAAAAAAGTGG + Intergenic
1033548074 7:142420738-142420760 ACTGTGGCTTCACAATGCAGTGG + Intergenic
1035671059 8:1417404-1417426 AGGTTTGCTTCAACAATCAGAGG - Intergenic
1038376925 8:27049017-27049039 ACACTTGCCACAAAAAGCAGGGG + Intergenic
1039212779 8:35235642-35235664 ACGATCGCTTCCTAAAGCAGCGG - Exonic
1041981444 8:63866011-63866033 ACTGCTTATTCAAAAAGCAGGGG + Intergenic
1046378477 8:113419878-113419900 ATGGTAGCCTTAAAAAGCAGAGG + Intronic
1050845916 9:10218132-10218154 AAGGCTGTTTCCAAAAGCAGTGG - Intronic
1052473696 9:28931802-28931824 ACAGTTGCTTCAAAAGGCAGTGG + Intergenic
1054743989 9:68835739-68835761 AAGGTTGTTTCAAAAAGCAGTGG + Intronic
1061237263 9:129350400-129350422 ACGGTTGCCCCATACAGCAGAGG - Intergenic
1061473649 9:130847767-130847789 CCTGTTGAATCAAAAAGCAGTGG + Intronic
1061649160 9:132032449-132032471 ACTGTTGTTTCAAAACACAGGGG + Intronic
1195168933 X:102247116-102247138 ACGGTTCCTTCTCAAAGCAGTGG - Intergenic
1195189924 X:102439970-102439992 ACGGTTCCTTCTCAAAGCAGTGG + Intronic
1196750655 X:119114625-119114647 ACTTTTTCTGCAAAAAGCAGAGG - Intronic
1199627409 X:149753124-149753146 ACTGTTGCCTCAAGAAGCACAGG + Intergenic