ID: 1182690978

View in Genome Browser
Species Human (GRCh38)
Location 22:32162354-32162376
Sequence ACGGTTGCTTCAAAAAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690975_1182690978 5 Left 1182690975 22:32162326-32162348 CCACAGGGAGTGTTATCACAGGA No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG No data
1182690973_1182690978 17 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG No data
1182690968_1182690978 29 Left 1182690968 22:32162302-32162324 CCACAAAAGAGACCATAAAAGGG No data
Right 1182690978 22:32162354-32162376 ACGGTTGCTTCAAAAAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690978 Original CRISPR ACGGTTGCTTCAAAAAGCAG AGG Intergenic