ID: 1182690982

View in Genome Browser
Species Human (GRCh38)
Location 22:32162362-32162384
Sequence TTCAAAAAGCAGAGGAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182690973_1182690982 25 Left 1182690973 22:32162314-32162336 CCATAAAAGGGGCCACAGGGAGT No data
Right 1182690982 22:32162362-32162384 TTCAAAAAGCAGAGGAGTGGGGG No data
1182690975_1182690982 13 Left 1182690975 22:32162326-32162348 CCACAGGGAGTGTTATCACAGGA 0: 2
1: 0
2: 0
3: 10
4: 132
Right 1182690982 22:32162362-32162384 TTCAAAAAGCAGAGGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182690982 Original CRISPR TTCAAAAAGCAGAGGAGTGG GGG Intergenic
No off target data available for this crispr