ID: 1182692987

View in Genome Browser
Species Human (GRCh38)
Location 22:32176486-32176508
Sequence GGTCAAATGCCTGGAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182692987_1182693007 28 Left 1182692987 22:32176486-32176508 CCGCCCCCTCCAGGCATTTGACC No data
Right 1182693007 22:32176537-32176559 CGTCCTAGAAGTCTCCTGGGGGG No data
1182692987_1182693000 24 Left 1182692987 22:32176486-32176508 CCGCCCCCTCCAGGCATTTGACC No data
Right 1182693000 22:32176533-32176555 GCCCCGTCCTAGAAGTCTCCTGG No data
1182692987_1182693006 27 Left 1182692987 22:32176486-32176508 CCGCCCCCTCCAGGCATTTGACC No data
Right 1182693006 22:32176536-32176558 CCGTCCTAGAAGTCTCCTGGGGG No data
1182692987_1182693002 25 Left 1182692987 22:32176486-32176508 CCGCCCCCTCCAGGCATTTGACC No data
Right 1182693002 22:32176534-32176556 CCCCGTCCTAGAAGTCTCCTGGG No data
1182692987_1182693004 26 Left 1182692987 22:32176486-32176508 CCGCCCCCTCCAGGCATTTGACC No data
Right 1182693004 22:32176535-32176557 CCCGTCCTAGAAGTCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182692987 Original CRISPR GGTCAAATGCCTGGAGGGGG CGG (reversed) Intergenic
No off target data available for this crispr