ID: 1182697709

View in Genome Browser
Species Human (GRCh38)
Location 22:32207601-32207623
Sequence CTTCTCCTGCAGAATCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182697698_1182697709 28 Left 1182697698 22:32207550-32207572 CCTCTGGGGCAGCGGTGGAGGCG No data
Right 1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG No data
1182697704_1182697709 2 Left 1182697704 22:32207576-32207598 CCTGGGGAAGGAGGAGTCTCCTC No data
Right 1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182697709 Original CRISPR CTTCTCCTGCAGAATCTGGA GGG Intergenic
No off target data available for this crispr