ID: 1182702504

View in Genome Browser
Species Human (GRCh38)
Location 22:32251932-32251954
Sequence GAAAATAGACAGATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182702502_1182702504 -7 Left 1182702502 22:32251916-32251938 CCAAATCAGACTTCTTGAAAATA 0: 1
1: 1
2: 0
3: 31
4: 305
Right 1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG 0: 1
1: 0
2: 0
3: 31
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182702504 Original CRISPR GAAAATAGACAGATGTAGCT GGG Intronic
901272372 1:7962166-7962188 GCAGAGAGACAGATGTAGTTGGG + Intronic
901705504 1:11070074-11070096 AAAAAGAAACAAATGTAGCTGGG + Intronic
901894696 1:12300966-12300988 AAAAATAGGCATAAGTAGCTGGG - Intronic
901963173 1:12843648-12843670 TATAAAAGACAGATATAGCTTGG + Intergenic
901990367 1:13107971-13107993 TATAAAAGACAGATATAGCTCGG + Intergenic
902294803 1:15459736-15459758 GAAATAAGGCAGATCTAGCTGGG + Intronic
903691912 1:25180203-25180225 GAAAAGAGAAAGATGAAGATGGG + Intergenic
904736553 1:32638751-32638773 GAAAATAGAAAAAATTAGCTGGG + Intronic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
910966598 1:92814409-92814431 GAAAAAAGAAAGAATTAGCTGGG - Intergenic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911720598 1:101187119-101187141 GAAAAGAGTCAGATAGAGCTGGG - Intergenic
911886018 1:103300687-103300709 GAAAATATACAAAATTAGCTGGG + Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
913299126 1:117352226-117352248 AAAAATACACAGAATTAGCTGGG - Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
913578422 1:120200555-120200577 GAAAATACAAAGAATTAGCTGGG + Intergenic
913629750 1:120697796-120697818 GAAAATACAAAGAATTAGCTGGG - Intergenic
914463401 1:147905750-147905772 AAAAATAGATACATGTGGCTGGG + Intergenic
914560345 1:148811995-148812017 GAAAATACAAAGAATTAGCTGGG + Intronic
914612488 1:149318220-149318242 GAAAATACAAAGAATTAGCTGGG - Intergenic
915134927 1:153724370-153724392 AAAAATAGAAAAATATAGCTGGG + Intergenic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
917264924 1:173210734-173210756 GAAAAGAGACAGATATGGCAAGG + Intergenic
917839606 1:178967012-178967034 GAAAATAGAGAAATGTGGCTGGG + Intergenic
917864914 1:179185129-179185151 GAAAGTAGACAGATGCATATTGG - Intronic
918372516 1:183875517-183875539 GACATTAGACAGATGCACCTTGG - Intronic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919543333 1:198879073-198879095 CAAAATAGACAAATGTCCCTGGG + Intergenic
921234987 1:213117480-213117502 GCAAAAAGACAGATGTATATAGG + Intronic
921310663 1:213839956-213839978 ACAAATAGGCAGATGAAGCTTGG - Intergenic
921412118 1:214846710-214846732 GAAAATAACAAGATGTAGCAAGG + Intergenic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
922303533 1:224324587-224324609 GAAAATAGAAATAATTAGCTGGG - Intronic
922893786 1:229083839-229083861 GAAAATAGAAAAAAATAGCTGGG - Intergenic
923825576 1:237496107-237496129 TAAAATAGTGAGATGTGGCTGGG + Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924636770 1:245795555-245795577 GAAATTAAAAAGATATAGCTAGG - Intronic
1063826555 10:9904981-9905003 GAAAGTATACAAATTTAGCTTGG + Intergenic
1064444984 10:15385060-15385082 GAAAATAAACAAAATTAGCTGGG + Intergenic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064966860 10:21022997-21023019 GACAATAGACAGAGGAAGTTAGG + Intronic
1065098751 10:22311726-22311748 GAAAATAAACAAATGTAATTTGG - Intergenic
1065821456 10:29529417-29529439 GAAAATAGAAACATGAAACTTGG - Intronic
1067915948 10:50398837-50398859 TATAATAGACAGTTCTAGCTAGG + Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069050055 10:63782844-63782866 GAAAAAAGAAAGATAAAGCTGGG + Intergenic
1070187343 10:74077472-74077494 GAAAATAGAAATTGGTAGCTAGG + Intronic
1070946034 10:80392506-80392528 GAAAATAGACAGTAGTTGCCGGG - Intergenic
1072091417 10:92131500-92131522 GAAAATAAAAATATTTAGCTTGG + Intronic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1075853290 10:125605895-125605917 AAAAATAGATAGATCTGGCTGGG - Intronic
1077094654 11:794199-794221 GAGAAGAGACAGATGTACCATGG + Intronic
1077635023 11:3836494-3836516 GAAACGAGACAGTGGTAGCTGGG + Intronic
1078782308 11:14450906-14450928 GAAAACAGACAGATGTCACTGGG - Intronic
1079790154 11:24727040-24727062 GAAAATAGAGAGATTTAAATTGG + Intronic
1079875205 11:25847618-25847640 GTAAATAGTCACATGTAGCTGGG - Intergenic
1080032692 11:27678532-27678554 GAAATTAGGGAGATGTAACTGGG + Intronic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1086480270 11:87228342-87228364 GAAAGGAGACAGATGTAGAAAGG - Intronic
1086816701 11:91380867-91380889 CAAAATATACAGGTGTTGCTAGG + Intergenic
1086948144 11:92864654-92864676 GAAAATAGAAAAAATTAGCTGGG + Intronic
1089080072 11:115768296-115768318 GAAAATAGAAAGATGTTTATTGG - Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1091564108 12:1635349-1635371 TAAATCAGACATATGTAGCTTGG + Intronic
1091774770 12:3177296-3177318 AAAAATACACAGAATTAGCTGGG - Intronic
1091984390 12:4896404-4896426 GTAAATAGCCACATGTTGCTAGG + Intergenic
1092170016 12:6368709-6368731 TAAAATAGCCAGAGGTAGCAGGG - Intronic
1092682527 12:11001286-11001308 TAAAATAGAATGGTGTAGCTAGG - Intronic
1093224396 12:16464302-16464324 GAGAAAAGAAAGATGAAGCTTGG - Intronic
1093268399 12:17027637-17027659 AAAAATAGACAAAACTAGCTGGG - Intergenic
1093424769 12:19016001-19016023 AAAAATACACAGAATTAGCTGGG + Intergenic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1093962298 12:25287483-25287505 GAAAATAGACATGGGTAGGTGGG - Intergenic
1094769666 12:33639405-33639427 GAAAATAGACAGCGTTACCTGGG + Intergenic
1099782989 12:87223496-87223518 GAAAATAGAAAAACTTAGCTGGG + Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1101377921 12:104187019-104187041 AAAAATAAAAAAATGTAGCTGGG - Intergenic
1101711602 12:107272266-107272288 GAAAGTAGACAGATATATGTTGG - Intergenic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104075759 12:125388266-125388288 AAAAATACACAAAAGTAGCTGGG + Intronic
1106912286 13:34475727-34475749 GCCAATAGAGAGATTTAGCTAGG - Intergenic
1107627546 13:42305292-42305314 TAAAATAGGGAGATATAGCTTGG + Intronic
1108538376 13:51410914-51410936 GAAAATAAGCACATGGAGCTGGG + Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1110296615 13:73874253-73874275 GAAAATAGACAGTTCTACATAGG + Intronic
1111637585 13:90926199-90926221 GAAAACAGCCAGAGGTGGCTGGG - Intergenic
1111831322 13:93333695-93333717 AAAAATAGAGAAATGTAACTGGG - Intronic
1112124997 13:96455378-96455400 GAAAAAAAAAAAATGTAGCTGGG - Intronic
1112530316 13:100195669-100195691 GAAAATAGAAAGAGGTTTCTAGG - Intronic
1113633483 13:111904217-111904239 GAAAATAGCAAGATGTGACTGGG + Intergenic
1114056303 14:18969969-18969991 GAAAATACAAAGAATTAGCTGGG + Intronic
1114106248 14:19431757-19431779 GAAAATACAAAGAATTAGCTGGG - Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114724016 14:24914646-24914668 AAAAATAGACAGCTGTAACAGGG - Intronic
1115219223 14:31042916-31042938 GAAATTTTTCAGATGTAGCTGGG + Intronic
1115260938 14:31453096-31453118 AAAAATAAACAAAAGTAGCTGGG - Intronic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1115879200 14:37895816-37895838 GAACAGAGACAAATGTTGCTTGG - Intronic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1116856484 14:49956777-49956799 GAAAATAGAAAAAATTAGCTGGG + Intergenic
1116899195 14:50345769-50345791 GAGAGTAGAAAGATGTACCTGGG - Intronic
1117007652 14:51438027-51438049 GAAAGTAGACAGATGCATGTTGG - Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1118100889 14:62601343-62601365 AAAAATAGACAAATGGGGCTGGG + Intergenic
1118197846 14:63644621-63644643 GAAAATAGAAAAAATTAGCTGGG - Intergenic
1119492307 14:75046017-75046039 GAAAATAAAAAAATTTAGCTGGG + Intronic
1119944506 14:78678442-78678464 GAAAATATACTGGAGTAGCTGGG - Intronic
1121136452 14:91503284-91503306 GAAAAAAAAAAAATGTAGCTCGG - Intronic
1121293636 14:92798152-92798174 GTCAATAGACAGTTGTAGCAGGG + Intronic
1121669895 14:95700882-95700904 GAAAAAAGGCAGTTGTAACTTGG + Intergenic
1122148952 14:99713581-99713603 GAAAATAGACAAACGTGGCCAGG + Intronic
1124112931 15:26808666-26808688 GTAAATAGCCACATGTGGCTTGG - Intronic
1124356133 15:28996191-28996213 GAAAGTAGACACATGTATATCGG + Intronic
1125199364 15:37087368-37087390 GAAAATAGATACAAGAAGCTAGG + Intronic
1126236132 15:46386707-46386729 GAAAACAGACTGATTTAGCAAGG + Intergenic
1127236285 15:57056299-57056321 GAAAATACAGAAAAGTAGCTGGG - Intronic
1127486515 15:59422768-59422790 GAAACTAGATAGAGGTGGCTGGG - Intronic
1127904015 15:63362849-63362871 GAGAAGAGACAGAAGTAGCCAGG - Intronic
1129849465 15:78784071-78784093 GAAAATAGAAACAGGTGGCTGGG + Intronic
1130770886 15:86922449-86922471 AAAAATACACAGAATTAGCTGGG - Intronic
1131318426 15:91362861-91362883 GAAAAAAGACAAATATAGGTAGG + Intergenic
1131495903 15:92910553-92910575 AAAAATAGTAAGAAGTAGCTGGG - Intronic
1131929651 15:97426988-97427010 GTAAATAGCCAGATGCAACTTGG - Intergenic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1132595078 16:745441-745463 GAAAATAGAAAAAATTAGCTGGG + Intronic
1133296141 16:4753299-4753321 GAAAATAAACAAAACTAGCTGGG + Intronic
1134397751 16:13880842-13880864 GAACATAAACAGAAGTAGGTAGG - Intergenic
1135035109 16:19070571-19070593 AAAAATATAAAAATGTAGCTGGG + Intronic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1135573805 16:23569392-23569414 GAAAATACAAATATTTAGCTGGG + Intronic
1136901797 16:34048104-34048126 GAAAAAATAGAGATGTAGATGGG - Intergenic
1137002732 16:35244868-35244890 GAAAATATACAAATATACCTTGG - Intergenic
1137012265 16:35334236-35334258 GAAAATATACAGATATACCTTGG - Intergenic
1137016629 16:35383017-35383039 GAAAATATACAGATATACCTTGG - Intergenic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1138667856 16:58586930-58586952 GAAAATAGAGAGTTGTTGATGGG + Intronic
1139609212 16:68043001-68043023 AAAATTAGCCAGATGTGGCTGGG - Intronic
1139842477 16:69892692-69892714 GAAAATAAACAAAATTAGCTGGG - Intronic
1140852254 16:78946149-78946171 GAAAATAGGCAGAGGTGTCTCGG - Intronic
1141221520 16:82073542-82073564 GAAAATAGATGGACATAGCTGGG - Intronic
1141980767 16:87548710-87548732 GAAAATAGAAAGATGGAGGCCGG + Intergenic
1142147270 16:88497838-88497860 GAGATTAGTCAGATGGAGCTCGG - Intronic
1142968889 17:3597965-3597987 GAAAATAGACACTTGTGGCCGGG - Intergenic
1144567172 17:16369194-16369216 TAAAAAAGAAAGATGTAGCCTGG - Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1145896555 17:28461486-28461508 GAAAATAGAAAAATTTAGCCGGG - Intronic
1146227204 17:31077508-31077530 TAAAAAATACAGAAGTAGCTGGG + Intergenic
1146898679 17:36565916-36565938 GAGAATAGAAGGATGTAGCATGG + Intronic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148947274 17:51274744-51274766 GAAAAGAGACCTATGTCGCTGGG - Intronic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149620076 17:58037765-58037787 AAAAATAGAAAGAATTAGCTGGG - Intergenic
1150335037 17:64324841-64324863 GAAAGTAGACAGTGGTTGCTAGG + Intronic
1151471461 17:74320844-74320866 AAAAATAGAAAGAATTAGCTGGG + Intergenic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1153308139 18:3651495-3651517 AAAAATAGAAAGATTCAGCTGGG + Intronic
1155400322 18:25431937-25431959 GAAAATATAAAGATGAACCTAGG + Intergenic
1155980324 18:32172811-32172833 AAAAATTGACTGATATAGCTAGG - Intronic
1156438912 18:37164583-37164605 AAAAATAGAAAGAGTTAGCTGGG + Intronic
1158640521 18:59199771-59199793 GAAAATAAACAAAATTAGCTGGG + Intergenic
1159733487 18:72062573-72062595 GGAAATAAACAGATGTAGTCAGG + Intergenic
1160983034 19:1825344-1825366 GAAAACAGAGGGATGAAGCTGGG + Intronic
1162038295 19:7954138-7954160 AAAAATACAAAGATTTAGCTGGG - Intergenic
1162051602 19:8037285-8037307 GAAAAGAGAAAGAAGAAGCTGGG - Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162151447 19:8648520-8648542 CAAAAAAGGCAGATGTGGCTGGG + Intergenic
1162320421 19:9968249-9968271 GAAAATAGGGGGATGTATCTGGG - Intronic
1162323584 19:9985553-9985575 AAAATTAGCCAGATGTGGCTGGG - Intronic
1163169701 19:15522513-15522535 GAAAATAGAAAAAATTAGCTGGG + Intronic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1164194016 19:22937814-22937836 AAAAATAGAAAAATATAGCTAGG + Intergenic
1165173523 19:33909990-33910012 GAAAATACAAAGAATTAGCTGGG + Intergenic
1165977136 19:39686113-39686135 GAAAATAGACAGCAGTCACTGGG + Intergenic
1167273995 19:48524104-48524126 GAAAATAGGAAGAAATAGCTGGG - Intergenic
928553103 2:32393678-32393700 AAAAATAAACAGAATTAGCTGGG - Intronic
928871979 2:35990806-35990828 CAAAATAGACACATGTAGTCTGG - Intergenic
929503057 2:42506568-42506590 GAAAATAGAGAGGTGTAGGCGGG + Intronic
929835351 2:45391692-45391714 GCAAAAAGACAGATGCATCTGGG - Intronic
931518053 2:63063501-63063523 GAAAATAGAAAGATGAGACTTGG - Intergenic
932502093 2:72191976-72191998 GAAAATAGAAATATGGAGCCTGG + Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933310002 2:80648693-80648715 GCAAATACATAGGTGTAGCTTGG + Intronic
933660396 2:84922929-84922951 GAAAATACAAAGAATTAGCTGGG + Intergenic
934079501 2:88455503-88455525 AAAAATAGACAGTTGCAGATCGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
936239262 2:110772998-110773020 GTAAATTGACAGCTGTAGCCTGG + Intronic
938867081 2:135433699-135433721 GAAATTAGCCAGGTGTGGCTGGG + Intronic
940154996 2:150646181-150646203 GAAAATAGACAGATGATTTTGGG - Intergenic
941367648 2:164626749-164626771 AAAAATAGAAAAATTTAGCTGGG - Intergenic
941438602 2:165505256-165505278 GAAAATAGACAGAAATAAATGGG - Intronic
941634584 2:167922978-167923000 AAAAATAGAAAAATTTAGCTAGG + Intergenic
942622657 2:177864207-177864229 GAAAATAGGGAGATGTAGGTCGG + Intronic
943748771 2:191489497-191489519 GAAAAGAGAGAGAAGAAGCTTGG - Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
945591649 2:211739762-211739784 TAAAATAGCCAGATGAGGCTGGG - Intronic
945963645 2:216162685-216162707 GAAAATAGGAAGATGTGGCCGGG - Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
946475542 2:220003363-220003385 TTAAATAGCCACATGTAGCTAGG + Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1170792884 20:19522145-19522167 GTAGATAGCCACATGTAGCTAGG + Intronic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1173295490 20:41751806-41751828 AAAAATAGAAAAATTTAGCTGGG + Intergenic
1173364476 20:42372442-42372464 GAAAATATACAAATTTAGCTAGG - Intronic
1173378944 20:42519364-42519386 GAAACAAGACAGATGTCCCTTGG - Intronic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1174801944 20:53571563-53571585 AAAAATACACAAATTTAGCTGGG - Intronic
1175112077 20:56655489-56655511 AAAAAGATACATATGTAGCTGGG + Intergenic
1175524013 20:59621271-59621293 GCACATAGACTGATGTAGCCGGG + Intronic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1175850101 20:62085785-62085807 GAAAATACAAAGAATTAGCTGGG - Intergenic
1177014306 21:15765267-15765289 GAGAATATAAAGATGTAACTGGG + Intronic
1177185989 21:17796877-17796899 GAAATTAAACAGATGATGCTGGG + Exonic
1177679491 21:24347399-24347421 GAAAATACACAAAATTAGCTGGG - Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178856868 21:36257652-36257674 GTAAATAGATAGATGTAGGTAGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179226979 21:39462832-39462854 GAAAATACATACATTTAGCTAGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182098352 22:27640850-27640872 AGAAATAGACAGTTGTGGCTGGG - Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182838993 22:33369432-33369454 GAAAATAGAAAAAAGAAGCTTGG - Intronic
1184780145 22:46644433-46644455 GAAAAGGGACAGATGTAACACGG - Intronic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
949976152 3:9462290-9462312 GAATATAGATAGATGGAGCCAGG + Intronic
950041330 3:9921151-9921173 GGAAATAGAAAGATGAATCTTGG + Intronic
951443088 3:22745092-22745114 GAAAATAGCAATATGTAGCTTGG - Intergenic
951618461 3:24574648-24574670 GTAAATAAACAGTTGTGGCTGGG - Intergenic
951664264 3:25104481-25104503 GAAAATATAAAAATTTAGCTTGG + Intergenic
952052203 3:29397842-29397864 TAAAATAGAGAAATGTAGCCAGG - Intronic
953167717 3:40480244-40480266 TTAAATAGGCACATGTAGCTAGG - Intronic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
954601537 3:51874400-51874422 GAAAATGGAATGAGGTAGCTAGG - Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956819545 3:72941232-72941254 GAATAGAGACACATGTAGCAGGG - Intronic
956827433 3:73011318-73011340 GAAAATAGAAAAAATTAGCTGGG + Intronic
957043753 3:75358234-75358256 GAAAATAGAAAAAATTAGCTGGG + Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957544022 3:81613510-81613532 GAAAATAGACAGATACATGTTGG - Intronic
959193037 3:103140243-103140265 GAAAATTGACACAAGTAACTTGG + Intergenic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960601891 3:119467311-119467333 GAAAATAGATAAATATTGCTGGG + Intronic
960831534 3:121854509-121854531 TAAAAAAGACAGATGAAGATAGG - Intronic
961600606 3:128058564-128058586 TAAAATACACACATGTGGCTGGG + Intronic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
962095320 3:132286798-132286820 AAAAATAAACAAAGGTAGCTGGG - Intergenic
962223605 3:133585653-133585675 AAAAATACAAAGATGTAGCGGGG - Intronic
962970007 3:140391314-140391336 AAAAATAGGCAGATGTTGGTGGG - Intronic
963132525 3:141872103-141872125 AAAATTAGCCAGATGTAGCCGGG + Intergenic
963432523 3:145227996-145228018 GAAAGTAGACAGATATAACAAGG + Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964861280 3:161204505-161204527 GATAATAGACAAATATAGCGTGG + Intronic
966277920 3:178198010-178198032 AAAAATAGAAAAATTTAGCTGGG + Intergenic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966767340 3:183475130-183475152 GAAAATAGCCAGAGGTAGAAGGG - Intergenic
967569244 3:191009095-191009117 GAAAAGAGACATATGAAGCTAGG + Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
967760457 3:193218973-193218995 GAAAATAGAGATATTTATCTTGG + Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
968057849 3:195706327-195706349 GAAATTAGACAGAGGTGGCCAGG - Intergenic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
971901855 4:32670251-32670273 GAAAATGGACCGATATACCTAGG + Intergenic
972262764 4:37427150-37427172 GAAAGTATACAGATGGAGTTTGG - Intronic
972669155 4:41196979-41197001 GAACATAGACTGATGTCACTGGG + Intronic
974040478 4:56852957-56852979 AAAAATAGAAAAAAGTAGCTGGG + Intergenic
974579549 4:63778041-63778063 GACAATAGCCAGATATAGCTTGG + Intergenic
975119975 4:70717720-70717742 GTATCTAGACAGAAGTAGCTTGG + Intronic
975140007 4:70908888-70908910 AAAAATAGAAAAAAGTAGCTGGG + Intronic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
975699956 4:77054833-77054855 TAAAACCTACAGATGTAGCTAGG + Intronic
977481210 4:97578263-97578285 AAAAATACACAAATTTAGCTGGG - Intronic
979015958 4:115434020-115434042 GATAACAGACACATATAGCTAGG - Intergenic
979537535 4:121840622-121840644 AGAAATAGAGAAATGTAGCTAGG + Intronic
981304339 4:143230316-143230338 GAAAATACACAAAATTAGCTGGG - Intergenic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982287853 4:153753716-153753738 AAAAATAGAAAAATTTAGCTGGG - Intronic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
987285143 5:16448718-16448740 GAAAATACACAAAATTAGCTGGG - Intergenic
987551645 5:19389980-19390002 GAAAATAAACATGTGTTGCTTGG - Intergenic
988277564 5:29101478-29101500 GAAAATATACAGATGACACTTGG + Intergenic
990384965 5:55251587-55251609 AAAAATAGAAAAAAGTAGCTGGG - Intergenic
990873494 5:60459412-60459434 GAAAATAGACAGATACATGTTGG + Intronic
991404393 5:66287872-66287894 AAAAATATACAAAAGTAGCTGGG + Intergenic
991553687 5:67871583-67871605 GAAATTAGAGAGGTCTAGCTGGG + Intergenic
993574115 5:89580396-89580418 AAAAATAGAAAGAATTAGCTTGG - Intergenic
993597701 5:89880317-89880339 CAATATAGAGAGATGTAGTTGGG - Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994768064 5:103946255-103946277 GAAAATAGAAAAAATTAGCTGGG - Intergenic
995038248 5:107559567-107559589 GAACATAAACAGATGTAGTTGGG - Intronic
995768020 5:115639854-115639876 GACAATTGAAAGATGTTGCTGGG + Intergenic
996401339 5:123066396-123066418 AAAAATAGAAAGTTGTGGCTGGG + Intergenic
997024067 5:130037223-130037245 GAAATTAGACAGAAGGAGCATGG + Intronic
997029712 5:130112240-130112262 GAAAATATTCAGAAGTAGCAAGG - Intronic
997596762 5:135112226-135112248 GAGCAGAGACAGATGTGGCTGGG + Intronic
998364485 5:141619987-141620009 CACAAGGGACAGATGTAGCTGGG - Intergenic
999372055 5:151061819-151061841 GAAAACAGACAGATGTGACATGG - Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000946775 5:167431638-167431660 GTATATAGATAGATGTAGATAGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001434667 5:171690023-171690045 GATGATAGACAGATATAGATAGG + Intergenic
1001466328 5:171969862-171969884 GAAAATAGAAAAAATTAGCTGGG - Intronic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1008015217 6:46511045-46511067 GAAAATGGACATTTTTAGCTTGG + Intergenic
1008423990 6:51335152-51335174 GAAACTAGACAACTGTACCTTGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1009323402 6:62319017-62319039 GAACATAGGCCTATGTAGCTGGG - Intergenic
1009421046 6:63465339-63465361 AAAAATACAAAGATTTAGCTGGG - Intergenic
1010092028 6:71994135-71994157 AAAAATAAACAAAAGTAGCTAGG - Intronic
1010454103 6:76035199-76035221 GAAGATAGAAAGATGTGGCGAGG + Intronic
1010813659 6:80329450-80329472 GAATATATACAGGGGTAGCTAGG - Intronic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1011951993 6:92978276-92978298 GAAAATACAAAGAGTTAGCTGGG + Intergenic
1012731009 6:102880461-102880483 GAAAATAGACATAAATGGCTAGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013937549 6:115616443-115616465 GAAAATAGAGAGATATATTTTGG + Intergenic
1013941950 6:115675061-115675083 GAAAATACAAAGAATTAGCTGGG - Intergenic
1015734208 6:136380323-136380345 GAAATTAGACACATGTTGCCAGG + Intronic
1016383093 6:143505475-143505497 AAAAATAGACAAAATTAGCTGGG - Intronic
1016871446 6:148821128-148821150 GAAAATACACAAAATTAGCTGGG - Intronic
1017980378 6:159395817-159395839 GACACCAGACAGATGGAGCTGGG + Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020247702 7:6442755-6442777 TAAAATACACAGAGCTAGCTGGG + Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021422187 7:20458175-20458197 GAAAAAAAAAAGAAGTAGCTGGG - Intergenic
1021826323 7:24555945-24555967 CAAAATAGACAGATGTACTGTGG + Intergenic
1021945577 7:25723438-25723460 GGAAATAGCCACATGTAGCTAGG - Intergenic
1023894054 7:44417467-44417489 GAAAATAACCAGTTTTAGCTTGG + Intronic
1024048245 7:45599924-45599946 GGAAAAAGACAGATGTGGCAAGG - Intronic
1024186539 7:46953883-46953905 GCATATAGACAGATATAGCTTGG + Intergenic
1024350811 7:48360934-48360956 GAAAATAAACAAAATTAGCTGGG + Intronic
1025076438 7:55947759-55947781 AAAAATACACAAAAGTAGCTGGG - Intergenic
1026767140 7:73167175-73167197 CAAAAAAGTCAGTTGTAGCTGGG + Intergenic
1027043609 7:74976886-74976908 CAAAAAAGTCAGTTGTAGCTGGG + Intronic
1027080038 7:75225473-75225495 CAAAAAAGTCAGTTGTAGCTGGG - Intergenic
1027796953 7:82707602-82707624 GAAAATAGACTGATGGGCCTTGG + Intergenic
1028589155 7:92478253-92478275 GAACATAGACAGAAGTCCCTGGG - Intergenic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029180585 7:98698621-98698643 GAAAAAAGAAAGATGAACCTTGG - Intergenic
1029389256 7:100264078-100264100 CAAAAAAGTCAGTTGTAGCTGGG - Intronic
1030385851 7:108867263-108867285 GAAAACAGACAGATGTCTCTGGG - Intergenic
1031097491 7:117438365-117438387 AAAAAGAGACAGATGTACCCAGG - Intergenic
1032027161 7:128452879-128452901 GAAAAAAGAAAGAATTAGCTGGG + Intergenic
1033423834 7:141225689-141225711 TAAAAATGACAGATGTAGCTGGG - Intronic
1035036064 7:155895006-155895028 TAAAAATGAGAGATGTAGCTGGG - Intergenic
1036076259 8:5504502-5504524 AAAAATACACAAAAGTAGCTCGG - Intergenic
1036947662 8:13109722-13109744 GAAAATACACAAAATTAGCTGGG + Intronic
1037189411 8:16104523-16104545 AAAAATAGACAAAATTAGCTAGG - Intergenic
1038720524 8:30031399-30031421 GAAAATAGATAGCTATGGCTGGG + Intergenic
1039978156 8:42384436-42384458 GAAAAGAATCAGATGTAGCTGGG - Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041653676 8:60326978-60327000 GAAGATAGGGTGATGTAGCTGGG + Intergenic
1042211590 8:66386561-66386583 GAAAATAGAAAAAATTAGCTGGG - Intergenic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1044869324 8:96603019-96603041 GAATATATACAGATGTACCCAGG - Intronic
1045095154 8:98789865-98789887 TAAAATAGAAAAAAGTAGCTGGG + Intronic
1045279449 8:100737202-100737224 AAAAATAGACAAAATTAGCTGGG + Intergenic
1045526587 8:102945657-102945679 GAAAATAGACATAAGAGGCTGGG + Intronic
1046740728 8:117825885-117825907 GAAAAGAGCCAGTGGTAGCTAGG - Intronic
1047428544 8:124768938-124768960 ATAAATGGATAGATGTAGCTGGG + Intergenic
1048036697 8:130683804-130683826 AAAAGTAGAAAGATGTGGCTGGG - Intergenic
1048238159 8:132713009-132713031 AAAAATAGACAAAATTAGCTGGG - Intronic
1049582110 8:143417532-143417554 GAAAATAGACAGGGGAGGCTGGG + Intergenic
1050579647 9:7039093-7039115 GAAAATATACTGATGAAGTTAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053764810 9:41381317-41381339 GAAAAAAGCCAGAGGTAGCAAGG - Intergenic
1054878037 9:70116889-70116911 GAAAATAGAGAGAGGGAGATGGG - Intronic
1055050098 9:71970912-71970934 AAAAATACACAAATTTAGCTGGG - Intronic
1055703245 9:78969877-78969899 GAAAATAGACCTATGTGGATTGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056596708 9:88013697-88013719 GAAAATAGACATCTGTCCCTAGG + Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058396021 9:104555485-104555507 CAAAATAGACAAATGGGGCTAGG + Intergenic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1059169393 9:112111151-112111173 GAAAATAGAAAAACTTAGCTGGG - Intronic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1059965277 9:119607894-119607916 AAAATTAGACAGAAGCAGCTTGG - Intergenic
1061332906 9:129908137-129908159 AAAAATAAACAAAAGTAGCTGGG - Intronic
1061649590 9:132036362-132036384 GAAAATAGAAACAATTAGCTGGG - Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1186604481 X:11076311-11076333 GAGAATACAAAGAGGTAGCTAGG + Intergenic
1187382033 X:18811346-18811368 GAAAAAAGAGAGATCAAGCTGGG - Intronic
1187514594 X:19956871-19956893 GCAAACAGACAGATGTGTCTGGG + Intronic
1187997767 X:24946973-24946995 GAAAGTAGACAGATTAAGGTGGG - Intronic
1189278051 X:39801578-39801600 AAAAATAGACAGTTTTGGCTGGG - Intergenic
1189922502 X:45916126-45916148 GAAAATAAACAAAATTAGCTGGG - Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190307908 X:49096389-49096411 AAAAATAAACAAATTTAGCTGGG - Intronic
1190533298 X:51402492-51402514 AAAAATACACAAATTTAGCTGGG + Intergenic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197007355 X:121517599-121517621 GAAAAATGACAGAAATAGCTGGG - Intergenic
1198849731 X:140953492-140953514 TAAAATATACAGAATTAGCTGGG - Intergenic
1202186494 Y:22190392-22190414 GAAAATAGCTAGAAGTATCTGGG - Intergenic
1202204865 Y:22396004-22396026 GAAAATAGCTAGAAGTATCTGGG + Intronic