ID: 1182706031

View in Genome Browser
Species Human (GRCh38)
Location 22:32280976-32280998
Sequence CAACAGTTCTAGAAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182706023_1182706031 21 Left 1182706023 22:32280932-32280954 CCCTGAGACCCTGGGGGACGCCT No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data
1182706027_1182706031 1 Left 1182706027 22:32280952-32280974 CCTTTCTTCTGAGCCCCAGTCTC No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data
1182706019_1182706031 29 Left 1182706019 22:32280924-32280946 CCATCTTGCCCTGAGACCCTGGG No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data
1182706025_1182706031 13 Left 1182706025 22:32280940-32280962 CCCTGGGGGACGCCTTTCTTCTG No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data
1182706024_1182706031 20 Left 1182706024 22:32280933-32280955 CCTGAGACCCTGGGGGACGCCTT No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data
1182706026_1182706031 12 Left 1182706026 22:32280941-32280963 CCTGGGGGACGCCTTTCTTCTGA No data
Right 1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182706031 Original CRISPR CAACAGTTCTAGAAAACAAA AGG Intergenic
No off target data available for this crispr