ID: 1182709214

View in Genome Browser
Species Human (GRCh38)
Location 22:32310189-32310211
Sequence GTGGCCTTGCCTCCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182709214_1182709215 -9 Left 1182709214 22:32310189-32310211 CCAGGAGAGGGAGGCAAGGCCAC No data
Right 1182709215 22:32310203-32310225 CAAGGCCACCAGTTCCTTTTTGG No data
1182709214_1182709219 22 Left 1182709214 22:32310189-32310211 CCAGGAGAGGGAGGCAAGGCCAC No data
Right 1182709219 22:32310234-32310256 GCACCTATAGAGCATCATCCAGG No data
1182709214_1182709221 30 Left 1182709214 22:32310189-32310211 CCAGGAGAGGGAGGCAAGGCCAC No data
Right 1182709221 22:32310242-32310264 AGAGCATCATCCAGGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182709214 Original CRISPR GTGGCCTTGCCTCCCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr