ID: 1182710583

View in Genome Browser
Species Human (GRCh38)
Location 22:32320514-32320536
Sequence TGCAGAGACCAGGCAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182710575_1182710583 30 Left 1182710575 22:32320461-32320483 CCATCAGCAGGATGCCAGGTCAA 0: 1
1: 0
2: 4
3: 13
4: 125
Right 1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG 0: 1
1: 0
2: 6
3: 35
4: 337
1182710578_1182710583 -4 Left 1182710578 22:32320495-32320517 CCTGCACAATGGAGAGCCATGCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG 0: 1
1: 0
2: 6
3: 35
4: 337
1182710576_1182710583 16 Left 1182710576 22:32320475-32320497 CCAGGTCAAAAACAACAGCTCCT 0: 1
1: 1
2: 0
3: 15
4: 164
Right 1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG 0: 1
1: 0
2: 6
3: 35
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182710583 Original CRISPR TGCAGAGACCAGGCAGGCTT GGG Intergenic
900852260 1:5153455-5153477 TGCACAGAGCAGGGGGGCTTTGG - Intergenic
900913824 1:5620571-5620593 TGCAGAGAACAGTCAGTCATAGG + Intergenic
901303311 1:8215384-8215406 TGCAGAGACCAGGCAGGTGGGGG + Intergenic
901466104 1:9422174-9422196 TGCAGAGAGCAGCCGGGCTTAGG - Intergenic
901534061 1:9871355-9871377 AGCAGGGACCAAGCAGGCCTAGG - Intronic
902132780 1:14277996-14278018 TGATGAGACCAGTCAGGTTTGGG - Intergenic
902218614 1:14950398-14950420 TGCAGGGACCAGGCAGGAGAGGG + Intronic
902565326 1:17307758-17307780 TTCAAAGACCAACCAGGCTTGGG - Intergenic
902882766 1:19383729-19383751 TGGAGATACCAGGTAGGCTGTGG - Intronic
902890096 1:19436930-19436952 TGCAGACACCAGGAAGACCTTGG + Intronic
903168914 1:21540226-21540248 TGCAGTGCCCAGGCAGGGGTCGG - Intronic
903240354 1:21978568-21978590 TCCAAAGACCAGGCAGCCCTTGG + Intronic
903244101 1:22003202-22003224 TCCAAAGACCAGGCAGCCCTTGG + Intronic
903619217 1:24685835-24685857 GGCTGAGACCAGTTAGGCTTTGG - Intergenic
903693003 1:25187369-25187391 TTCAGAGGCCAGGGAGGGTTGGG + Intergenic
903755015 1:25654467-25654489 TCCTGGGACCTGGCAGGCTTGGG - Intronic
904547770 1:31289774-31289796 TGCAGAGATCAGACAGACTGTGG + Intronic
904976977 1:34464221-34464243 TGCTGTGACCAGGTAGGCATAGG + Intergenic
905003227 1:34689759-34689781 TACAGAGAGCAGGCAGGCTTGGG - Intergenic
905645764 1:39624218-39624240 TGGAGACACCAGGAAGGCTTGGG + Exonic
906026853 1:42681795-42681817 TGGAGGGACCACGCAGGCTATGG - Intergenic
906732078 1:48091460-48091482 TTCAGAGACTATGCAGGCTACGG - Intergenic
906977255 1:50588979-50589001 TGCAGGGACCAGCTAGGGTTAGG + Intronic
907309270 1:53530022-53530044 TGCTGGGGCCAGGCAGGCCTGGG - Intronic
909618000 1:77634464-77634486 TCTAGAGACTAGGAAGGCTTGGG - Intronic
911941446 1:104052554-104052576 TGCACAGAGCAGGCAGGCCCTGG + Intergenic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
913986547 1:143570825-143570847 AGCAGTGACCAGGGGGGCTTGGG + Intergenic
914582300 1:149029996-149030018 AGCAGTGACCAGGGGGGCTTGGG + Intronic
914847102 1:151289340-151289362 TGCAGACATCAGGCAGGGTTGGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916028230 1:160853982-160854004 TGCATACACCAGGCAGGCCTTGG - Intronic
916999899 1:170346197-170346219 TGTAGAGCCCAGGAAAGCTTTGG + Intergenic
917444826 1:175098450-175098472 TGGAGAGACCAGGGAGGTTCCGG + Exonic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
918104452 1:181404611-181404633 TTCAGAGATCAGACACGCTTTGG + Intergenic
918143639 1:181737856-181737878 TGCAGAGCCCTGGCCGGTTTGGG - Intronic
918250560 1:182699630-182699652 TGCAGCAACGAAGCAGGCTTTGG - Intergenic
919028976 1:192214842-192214864 TGAAAAGACCAGTCAGTCTTGGG + Intergenic
919483771 1:198121264-198121286 TGAGGAGACCAGGGAGGCCTGGG - Intergenic
921316659 1:213898066-213898088 TGCAGAGACCAGTAAGGACTTGG + Intergenic
921638577 1:217524743-217524765 TGCAGGCACTCGGCAGGCTTAGG + Intronic
921953417 1:220957301-220957323 TGCAGAGAGCCAGCAGGCATGGG + Intergenic
922531530 1:226349002-226349024 TGAAGAGAACAGTCAGGCTCAGG + Intergenic
922582992 1:226712323-226712345 TGCAGTGACCACGAAGGCTGGGG - Intronic
923525434 1:234768995-234769017 TGCAGAGACCATGAAGGACTTGG + Intergenic
923846358 1:237737013-237737035 TGCAGAGAACACCCAGGCTGGGG - Intronic
924022464 1:239798844-239798866 TGCAAAGACCAGTCAAGCTGTGG + Intronic
924652020 1:245938359-245938381 TCCAGGGATCAGGCATGCTTGGG - Intronic
924697368 1:246414441-246414463 TGTAGAGAAGAGACAGGCTTTGG - Intronic
1064359817 10:14654053-14654075 TGCAGGGGCCAGGCAGGATAGGG + Intronic
1065525158 10:26612742-26612764 TGGAGAGACTAGACTGGCTTAGG + Intergenic
1067057875 10:43062854-43062876 TGCAGATCCCAGGCAGGCAGAGG + Intergenic
1067265044 10:44734500-44734522 AGCAATGTCCAGGCAGGCTTTGG + Intergenic
1067823616 10:49552463-49552485 TGCAGATAACAAGCAGCCTTAGG + Intergenic
1070715596 10:78718803-78718825 TGCACAGGCCAGGCAGGAATGGG + Intergenic
1070962769 10:80510486-80510508 TGCTGAGACCAGGCAAGCCAAGG - Intronic
1073710575 10:106033305-106033327 TGCAGAGACAAGGCAGAAGTTGG + Intergenic
1074754717 10:116615766-116615788 AGAAGAGACCAGGCAGGCTTGGG + Intergenic
1075160701 10:120022228-120022250 GGCAGAGACCAGTCAGGCAGTGG + Intergenic
1075389616 10:122083208-122083230 TGCAGAGTCCAGGCAGGGGGTGG + Exonic
1075484488 10:122811081-122811103 GGCCAAGACTAGGCAGGCTTGGG + Intergenic
1075560686 10:123466342-123466364 AGAACAGACCAGGCAGGGTTTGG - Intergenic
1075653281 10:124144100-124144122 TGCACAGAACAGACAGGCTCTGG + Intergenic
1076070156 10:127482651-127482673 TGGAGAGCCCAGGCAGAGTTGGG + Intergenic
1076380334 10:130020944-130020966 TGCAGTGACCAGGGAGGGTGTGG - Intergenic
1077087900 11:763710-763732 AGCTGTGACCAGGAAGGCTTCGG - Intronic
1078156003 11:8800622-8800644 TGCTGAGCCCAGACAGGCCTAGG - Intronic
1079336582 11:19575517-19575539 TACAGAGACAAGGCAGGCAAAGG - Intronic
1080885386 11:36363050-36363072 TGCAGAGACAAACCAGGCTCAGG - Intronic
1081343733 11:41957172-41957194 TGTAGAGAGCAGGAAGGGTTAGG - Intergenic
1082012661 11:47460736-47460758 TGCAGAAACAAGGCTGGATTGGG + Intergenic
1082255250 11:50027092-50027114 TGCACACAGCAGGAAGGCTTTGG - Intergenic
1083653739 11:64219354-64219376 TGCAGGTACCAGGCGGGCCTGGG + Exonic
1083756547 11:64794798-64794820 CTCAGAGACCGGGCAAGCTTGGG - Intronic
1084588566 11:70077684-70077706 TGCAGAGGACACTCAGGCTTAGG - Intergenic
1084861720 11:72023104-72023126 TGCAGATACCAGGCATTCTGGGG + Exonic
1091098265 11:132844407-132844429 TGCAGAGGCCTTGCTGGCTTGGG + Intronic
1092022321 12:5212754-5212776 TGCAGAGGGCATGCTGGCTTTGG + Intergenic
1092077100 12:5683033-5683055 GGCAGAGAAGAGGCAGGCTTGGG - Intronic
1097191267 12:57220674-57220696 GGCAAAGACCAGGCAGGATCAGG - Intronic
1097805598 12:63961434-63961456 AGCAGAGGCCAGGCAGGCCCTGG + Intronic
1099996662 12:89786379-89786401 TGCACAGAGCAGGGAGGCCTTGG - Intergenic
1101845356 12:108359070-108359092 TGCAGAGACCAGGCAGGTCATGG + Intergenic
1102061917 12:109939099-109939121 GCCAGAGACCTGGCAGGCCTGGG - Intronic
1102198680 12:111042460-111042482 TCCAGAGTCCAGGTAGTCTTTGG - Intronic
1102450661 12:113039588-113039610 TGCTGAGATCTGCCAGGCTTTGG - Intergenic
1102982408 12:117252364-117252386 TGCAGTGACCAGGCTGGATTTGG + Intronic
1103219591 12:119232508-119232530 TGCAGACAGCAGGCAGGGCTGGG + Intergenic
1103874060 12:124113802-124113824 TGCAGAAGCCAGGCAGGGCTTGG - Intronic
1104090476 12:125512693-125512715 TGAAAAGACCAGGCAGGCAGCGG - Intronic
1104609600 12:130217373-130217395 TGCAGGGGCCAGGCAGGATAAGG + Intergenic
1106144237 13:27037381-27037403 TGCGGTGGCCAGGAAGGCTTTGG - Intergenic
1106273313 13:28176002-28176024 TGGAGAGACCATACAGGCTATGG + Intronic
1106356554 13:28989217-28989239 CACAGAGTCCAGGCAGGCTCAGG + Intronic
1107106869 13:36653094-36653116 TGCAGAGACAAAGCAGGCTTTGG + Intergenic
1107721815 13:43257139-43257161 GCCAGAGTCCAGGCAGGGTTAGG + Intronic
1108500901 13:51068829-51068851 TTCAGAGACCTGGCAGGCCTGGG - Intergenic
1108525225 13:51280666-51280688 TGGAAAGACCAGGGAGGGTTGGG - Exonic
1109788822 13:67220598-67220620 TGGTGAGACAGGGCAGGCTTTGG - Intronic
1110808235 13:79783035-79783057 TGAAAAGCCCAGGCAGGCGTGGG + Intergenic
1112498351 13:99923120-99923142 AGCAGAGACCAGGCAGGCCGGGG - Intergenic
1113364721 13:109665464-109665486 AGCAGCAACCAGGCAGGCATGGG - Intergenic
1113722456 13:112569977-112569999 TGCAGAGCCCAGGCAGGCTCAGG + Intronic
1114199631 14:20507861-20507883 TCCAGCTACCAGGCAGGCTGAGG - Intronic
1114483702 14:23050616-23050638 TGCAGAGCCCAGGCCAGCCTGGG + Intronic
1117015558 14:51513775-51513797 TGAAGAGACAAGGAAGGCATGGG - Intronic
1118733288 14:68684404-68684426 TGCGGAGTGCAGGCAGGTTTGGG - Intronic
1120051554 14:79873003-79873025 TGTATAAACAAGGCAGGCTTTGG - Intergenic
1120694683 14:87631529-87631551 GGCAGAGATGAGGCTGGCTTGGG - Intergenic
1121007403 14:90499200-90499222 TGGAGAGACCAGTCAGACTTGGG + Intergenic
1122148270 14:99707077-99707099 TGCAGAGGGAAGGCAGCCTTTGG - Intronic
1122192539 14:100057564-100057586 TTCACAGAGCAGGCAGGCTTAGG + Intronic
1122817273 14:104319917-104319939 TGCAGAACCCAGGCTGGCCTGGG + Intergenic
1122899256 14:104775435-104775457 TGCTGAGCCCTGCCAGGCTTGGG - Intronic
1202849248 14_GL000225v1_random:6589-6611 GGCAGAGACCAGGCAAGAGTTGG + Intergenic
1202850466 14_GL000225v1_random:14256-14278 GGCAGAGACCAGGCAAGAGTTGG + Intergenic
1202851240 14_GL000225v1_random:21558-21580 GGCAGAGACCAGGGAAGATTTGG + Intergenic
1202851920 14_GL000225v1_random:26284-26306 GGCAGAGACCAGGCAAGATTTGG - Intergenic
1202853198 14_GL000225v1_random:34627-34649 GGCAGAGACCAGGCAAGATTTGG + Intergenic
1202858667 14_GL000225v1_random:66721-66743 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1202859942 14_GL000225v1_random:74792-74814 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1202863031 14_GL000225v1_random:96047-96069 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1202863732 14_GL000225v1_random:101946-101968 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1202865016 14_GL000225v1_random:111222-111244 GGCAGAGACCAGGCAAGAGTTGG + Intergenic
1202867284 14_GL000225v1_random:129838-129860 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1124617037 15:31249273-31249295 TTCAGAGGCCAGGCAGGCACAGG + Intergenic
1126170745 15:45693315-45693337 TGCAGGGTCTAGGAAGGCTTGGG + Intergenic
1129660132 15:77548799-77548821 AGCCGGGACCAGGAAGGCTTGGG - Intergenic
1129786486 15:78313508-78313530 TGCAGAGACCGGGGAGGCAGAGG + Intergenic
1130149371 15:81299685-81299707 TGGCGAAACCAGGCTGGCTTGGG - Exonic
1132425564 15:101713326-101713348 GCCAGAGACCATGCAGGCCTTGG + Intronic
1132761975 16:1513108-1513130 TGCAGAGGCCCTGCAGGCATCGG + Intronic
1133961476 16:10497354-10497376 TGCACAGCACAGGCAGGCTGTGG - Intergenic
1134271215 16:12734952-12734974 TGCAGAGACCAGGCAAGGCAGGG + Intronic
1134643540 16:15848611-15848633 GGCAGAGACCAGGGATGCTGCGG - Intronic
1135345352 16:21684541-21684563 TACAGGGACCAGGCAGGCCATGG + Intronic
1136107116 16:28037904-28037926 TGTAGATACCAGGCAGTCATGGG - Intronic
1137237030 16:46625042-46625064 TGCAGAGGGCAGGGAGGCATGGG + Intergenic
1138314691 16:56059858-56059880 TGCAAATGCCAGACAGGCTTAGG + Intergenic
1138417477 16:56879612-56879634 AGCAGAGACAAGGCAGGCCAGGG - Exonic
1139953524 16:70682929-70682951 TGCAGTGACCAGGCAGACATGGG - Intronic
1140146932 16:72320146-72320168 TGCACAGAGCAGGCAGGCTGTGG + Intergenic
1140299284 16:73740318-73740340 AGCAGATACGAGGCAGGCTGGGG + Intergenic
1141470467 16:84234883-84234905 TTCAGAGAGCAGGGAGGCTGAGG - Intronic
1143752366 17:9037823-9037845 AGAAGAGACCAGGGAGGCTGAGG - Intronic
1144889936 17:18488835-18488857 GGCAGAGAACAGGCAGGCAGGGG - Intronic
1145010613 17:19365548-19365570 TGCAGGGTCCAGGCTGGCTGAGG - Intronic
1145142280 17:20455482-20455504 GGCAGAGAACAGGCAGGCAGGGG + Intronic
1145285636 17:21504118-21504140 TGCAGATCCCAGGCTGGCTTTGG + Intergenic
1145808444 17:27750975-27750997 GGGAGAGACCAGGCAGGCAGGGG - Intergenic
1146799661 17:35808609-35808631 TGCAGAGCCCAAGCGGCCTTGGG + Intronic
1147788672 17:42998864-42998886 TGCCGGGACCAGGCTGGCTGCGG + Intronic
1147889223 17:43705245-43705267 GGCAGAGAATAGGCAAGCTTGGG - Intergenic
1147986682 17:44310976-44310998 TTGAGAGCCCAGGCAGGGTTGGG - Intronic
1150815542 17:68389448-68389470 GGCTGAGACCAGGAAGGCGTGGG + Intronic
1151199828 17:72459587-72459609 TGCAGGGACCAGCCAGGCATGGG + Intergenic
1151250075 17:72827592-72827614 GGGAGACACCAGGAAGGCTTTGG + Intronic
1151382500 17:73735494-73735516 GGTAGAAACCAGGCAGCCTTTGG - Intergenic
1152168689 17:78728113-78728135 TGCAGGAACCAGCCTGGCTTGGG - Intronic
1152344519 17:79743033-79743055 TGCAGAGAGCAGGCTGGAATGGG - Intergenic
1152457958 17:80426905-80426927 GGCAGACACCAGGGAGGCTCAGG - Intronic
1152679171 17:81656834-81656856 TTCAGAGATCAGGCAGGGTCAGG - Intronic
1152965210 18:108232-108254 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1153810697 18:8749374-8749396 TGGAGAGGCCAGGCTGGCTGCGG + Intronic
1154348271 18:13562359-13562381 TGGAGAAACGAGGCAGGCTGAGG - Intronic
1155888105 18:31232928-31232950 TGTAGAGAGCAGTCAGGCCTGGG + Intergenic
1155890469 18:31261957-31261979 TTCAGAGACCCTGCAGGCTCAGG + Intergenic
1157986373 18:52442856-52442878 TGCAGGGGCCAGGCAGTCATGGG + Intronic
1158278554 18:55795234-55795256 TTCTTAGACCAGGCAGCCTTAGG - Intergenic
1159122840 18:64190643-64190665 TGCAGAGACACTGCAGACTTTGG + Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1160225826 18:77009860-77009882 TGCACAGCCCAGGCTGGCTGCGG + Intronic
1160362350 18:78294627-78294649 TGGCCAGACCAGGCGGGCTTGGG - Intergenic
1160426831 18:78783507-78783529 TGCAGAGAGGAGGCTGGCGTAGG - Intergenic
1160537429 18:79602651-79602673 TGAAGGGCCCAGGCAGGATTGGG - Intergenic
1161508467 19:4657264-4657286 TGCAGAGAGCAGGTCGGCCTTGG + Intronic
1161586785 19:5109991-5110013 TCCAGAGACCAGCGAGGCTGAGG - Intronic
1161622901 19:5308673-5308695 GGCAGGGACCTGGCAGCCTTGGG + Intronic
1161842827 19:6693272-6693294 TGCAGAGTCCAGGCAAGCGCTGG - Intronic
1163430006 19:17261751-17261773 TGCAGCTACCAGGGAGGCTAAGG - Intronic
1164374739 19:27674917-27674939 TGCAGACCCCAGGCAGTCTAAGG - Intergenic
1164458138 19:28426241-28426263 TCCAGTGACCAGGGAGGCTGAGG + Intergenic
1164603026 19:29576394-29576416 TGCACAGAGCAGCCCGGCTTTGG - Intergenic
1165154958 19:33781383-33781405 TCCACAGACCTGGCAGGCTGGGG + Intergenic
1165435807 19:35794104-35794126 GGCAGAGACCACGCTGGGTTGGG - Intergenic
1165740668 19:38203470-38203492 TGCAGCGGCCAGGCAGGCCCAGG + Intronic
1166557626 19:43711743-43711765 TGCAGATACTTGGCAGGCTGAGG - Intergenic
1166645729 19:44530391-44530413 TGCAGCTACTAGGCAGGCTGAGG - Intergenic
1167102138 19:47410150-47410172 TACAAAAACCAGGCTGGCTTGGG + Intronic
1168417864 19:56180669-56180691 TGCAGCAACCAGGCAGACTCGGG - Intronic
1168471334 19:56643179-56643201 TGCAGAGCCCAGACAGGGTCCGG + Exonic
925892029 2:8442089-8442111 AGCAGAGAGCAGGCAGGTGTGGG - Intergenic
926135355 2:10332205-10332227 TGGAGAGAGCAGTCAGGCTCTGG - Intronic
926209924 2:10862248-10862270 TTCAGAGACCAGGCTTGTTTTGG + Intergenic
926328477 2:11805535-11805557 TGCAGATTCCAGGCAAGTTTTGG + Intronic
926987455 2:18639901-18639923 TGCAGAGTCCAGGCAGACAGGGG - Intergenic
927255367 2:21036491-21036513 TGCAGGGGTCAGGCAGGCTCAGG + Intronic
929889456 2:45907011-45907033 TGCAGGGACCAGGCTGGATGGGG + Intronic
931720189 2:65061842-65061864 GGCAGAGGCCAAGCAGGCATGGG - Intronic
932344276 2:70985453-70985475 TGCAGAGAAAAGGGAGGCCTGGG - Intronic
932732903 2:74233047-74233069 TGCAGAGACCAGGAAGGCTAAGG + Intronic
933692666 2:85191412-85191434 AGCTGAGGCCAGGCAGGGTTTGG - Intronic
934525640 2:95049923-95049945 TGCAAAGCCCACGCAGGCCTGGG - Intronic
934765892 2:96879810-96879832 TGCAGGGACCCGGCAGGCAGAGG - Intronic
935272646 2:101448409-101448431 TGCAGAGGACATCCAGGCTTAGG - Intronic
936040937 2:109148950-109148972 GACAGAGCCCAGGCAAGCTTTGG + Intronic
936572355 2:113627358-113627380 TGGAGAGACCAGGGACGCTGCGG - Exonic
936986599 2:118316871-118316893 TGCAGCTACCAGGGAGGCTGAGG - Intergenic
937516300 2:122659855-122659877 AGCAGAGAGCAGGCAGCCTCAGG - Intergenic
938199143 2:129358615-129358637 TGGAGAGGCCATCCAGGCTTTGG + Intergenic
940005459 2:149006033-149006055 TCCAGAGACCCCGCAGGCCTGGG - Intronic
941065557 2:160898787-160898809 TACAGACACAAGGCAGGATTTGG - Intergenic
947601740 2:231455403-231455425 GGCAGAGGCCGGGGAGGCTTTGG - Exonic
947838312 2:233190606-233190628 TGCCCAGACCAGGCAGGCTGTGG + Intronic
948401198 2:237686834-237686856 TGCAGACAGCAGGCAGGGTCTGG + Intronic
948634700 2:239327735-239327757 TGCAGGGCACAGGCACGCTTTGG - Intronic
948699097 2:239749392-239749414 TTCAGACACCAGCCAGGCTGCGG + Intergenic
948800491 2:240431194-240431216 TTCAGAGTCCTTGCAGGCTTCGG + Intergenic
1169118228 20:3081074-3081096 GACAGGGACCATGCAGGCTTGGG - Intergenic
1170537737 20:17357965-17357987 TGCACTGAACAGACAGGCTTTGG - Intronic
1170835121 20:19877614-19877636 TGCAGAAAGCAGGTGGGCTTAGG - Intergenic
1171205056 20:23272626-23272648 TGCAGAGACCTGGCTGTCTTGGG - Intergenic
1171208294 20:23298088-23298110 TCCAGAGGCCAGCCAGGCTCTGG + Intergenic
1171498657 20:25576259-25576281 TGCAGACACCAGACAGACTCTGG - Intronic
1172045759 20:32079023-32079045 GGCAGAGCCAAGGCAGGCTGAGG + Intronic
1172234005 20:33357415-33357437 GGCAAAGGCCAGGGAGGCTTTGG + Intergenic
1172633829 20:36395988-36396010 AGCTGGGACCAGGCAGGCCTGGG - Intronic
1173012105 20:39191765-39191787 TGGAAAGACCAGGCAGTGTTGGG + Intergenic
1174618105 20:51851945-51851967 TGCAGTGACCAGGCCGGCCGCGG - Intergenic
1175524826 20:59626446-59626468 TGCAGAGACCAGGCAAAGTGAGG + Intronic
1175817583 20:61891498-61891520 TGCAGGGACCACGCAGGCATGGG + Intronic
1175941566 20:62539745-62539767 TGCAGATAGTAGGGAGGCTTGGG - Intergenic
1178567422 21:33700626-33700648 TACTGACACCAGGCATGCTTTGG + Intronic
1178567463 21:33701090-33701112 TACTGAGACCAGGCATGCTTTGG - Intronic
1178741037 21:35201551-35201573 TGCAGAGAACAGGCAACCTGGGG - Intronic
1179053692 21:37913009-37913031 TGCAGAGCCCAGTCAAGGTTTGG - Intronic
1179908896 21:44437789-44437811 TGCGGAGGCCAGGCTGGCCTGGG - Intronic
1180824418 22:18852827-18852849 GGCAGAGACAAGGCTGGATTTGG + Intronic
1181188316 22:21121721-21121743 GGCAGAGACAAGGCTGGATTTGG - Intergenic
1181210882 22:21288772-21288794 GGCAGAGACAAGGCTGGATTTGG + Intergenic
1181398626 22:22638116-22638138 GGCAGAGACAAGGCTGGATTTGG - Intergenic
1181501359 22:23317472-23317494 GGCAGAGACAAGGCTGGATTTGG - Exonic
1182125886 22:27815655-27815677 TGCAGAGAAGAGGCAGGTGTGGG + Intergenic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
1183327061 22:37199984-37200006 GGGAGACACCAGGCAGGCTCTGG + Intergenic
1183329859 22:37213562-37213584 TTAAGAGACCAGGCCGGCTCCGG - Intergenic
1185427834 22:50783521-50783543 TGGAGAGACCAGGGACGCTGCGG + Exonic
1203216065 22_KI270731v1_random:6658-6680 GGCAGAGACAAGGCTGGATTTGG - Intergenic
949385900 3:3502076-3502098 TGCAGGAACCAGGTTGGCTTAGG - Intergenic
949563944 3:5228160-5228182 GGCAGAGAGAAGGCAGGATTTGG + Intergenic
949896318 3:8769405-8769427 TCCAGCGACCAGCCAGGCTGCGG - Exonic
954200914 3:49022586-49022608 TGCAGGGACCAAGCAGGGTGAGG - Intronic
954430992 3:50470761-50470783 GGCAGAGAGCAGGCCGGGTTGGG + Intronic
954852902 3:53618317-53618339 TGCAGAGCCCAGCCAGACCTGGG - Intronic
959687381 3:109162585-109162607 TGCAGAGAGGAGGGAGTCTTTGG + Intergenic
961164046 3:124751230-124751252 TGCAGGCACTAGGCAGGCTGAGG + Intergenic
961650832 3:128415970-128415992 TGCCAGGACCTGGCAGGCTTGGG - Intergenic
961750148 3:129089739-129089761 TGCAGAGGGCAGGGAGGCATGGG + Exonic
962202580 3:133413966-133413988 TACAGGGGCCAGGCAGGCGTGGG - Intronic
962259417 3:133893759-133893781 TGCAGGGATCAGGCAGCCTGGGG - Intronic
968511710 4:998532-998554 AGCAGAGACCAGGCTGGCCAGGG - Intronic
968614031 4:1569315-1569337 CGGAGAGACCAGGCGGGCTGTGG - Intergenic
968652600 4:1766181-1766203 GGCAGAGCCCAGGCTGGCTGGGG + Intergenic
968892897 4:3380755-3380777 TGCATAGAGCAGGGAGGCCTTGG + Intronic
969174034 4:5385536-5385558 TCCAGAGGCCAGGCATGCTCCGG + Intronic
969591033 4:8122066-8122088 TGCAGGGACCTGGCAGGCTAGGG + Intronic
969691242 4:8705362-8705384 GGTAGAGACCAGGCTGGCCTGGG + Intergenic
970111331 4:12640824-12640846 TGCAGAGGACAGGCAGTCTTTGG - Intergenic
970493961 4:16607011-16607033 TGTAGAGAGAAGGCAGACTTGGG + Intronic
972391777 4:38620362-38620384 AACAGAGACCAGGCAGGGGTGGG + Intergenic
972816073 4:42646669-42646691 TCCAGAACCCAGGCTGGCTTTGG + Intronic
975612545 4:76216147-76216169 AGCAGAGAAGAGGCAGGATTAGG - Intronic
976542515 4:86294734-86294756 AGGAGAGACCAGGGAGGCTGAGG + Intronic
977502696 4:97861359-97861381 TGCAGAGAAAAGGGAGCCTTTGG + Intronic
981677326 4:147357389-147357411 TGCAGGCACTAGGCAGGCTGAGG - Intergenic
984158879 4:176226807-176226829 CGCAGAGCCCAGGCAAGCTGGGG - Intronic
984173563 4:176389346-176389368 TGCAGACCCCAGGCAGGTCTCGG - Intergenic
985464269 4:190179657-190179679 GGCAGAGACCAGGCAAGAGTTGG + Intronic
992111903 5:73502334-73502356 TGCAGTGAGCAGGCAGGCTAAGG - Intronic
993478384 5:88392589-88392611 TGCAGAAACCAGGAACGTTTGGG + Intergenic
996110680 5:119562982-119563004 TACACAGACCAGGCAGTCTTCGG - Intronic
999212766 5:149904707-149904729 TGCAGTGAGCAGGCAGTCCTTGG - Intronic
999238020 5:150111419-150111441 TGCAGAGGGCAGGCAGGGTCTGG - Intronic
1002160732 5:177312571-177312593 GGCAGATGGCAGGCAGGCTTGGG - Intronic
1002342756 5:178527542-178527564 TGCTGTGCCCAGGCAAGCTTGGG - Intronic
1003011927 6:2434512-2434534 TGCAGACAACAGGCAGGCACTGG + Intergenic
1003182003 6:3799947-3799969 TGCAAAGGCCAGGCAGGGTATGG + Intergenic
1003286279 6:4736510-4736532 AGCAGAGGCCAGGAAGGCTGTGG - Intronic
1003976555 6:11350491-11350513 TGCAAAGGCCAGGCAGACCTGGG + Intronic
1006596400 6:35195648-35195670 AGCAGAGATAAGCCAGGCTTTGG + Intergenic
1006813002 6:36832753-36832775 GGCAGAGAGGAGTCAGGCTTGGG - Intronic
1007078996 6:39085466-39085488 TGTAGACACCAGGAAGGCTGGGG + Intronic
1007352139 6:41281764-41281786 TGCAGAGCCCAGGAAGGCACAGG + Intronic
1007596327 6:43053410-43053432 TGCACAGACCAGGTAGGCGAGGG + Intronic
1008165522 6:48133565-48133587 TGCAGAAAGCATGAAGGCTTTGG - Intergenic
1008255277 6:49291706-49291728 CCCAGAGACCAGGGAGGCTGAGG - Intergenic
1013458091 6:110350292-110350314 TGCAGGGACCAGGAAGGCTCTGG - Intronic
1013479790 6:110543821-110543843 TGCAGAGACCAGGAGGTATTAGG + Intergenic
1015544971 6:134352364-134352386 AGCAGTCACCAGGCAGCCTTTGG - Intergenic
1016433199 6:144008605-144008627 TGCAGACCCCAGGCCGGCTCGGG - Intronic
1016457295 6:144244711-144244733 TGGTGAAACCAGCCAGGCTTGGG + Intergenic
1016763369 6:147765034-147765056 TGCACAGAGCAGACAAGCTTGGG - Intergenic
1017875322 6:158519609-158519631 TGCTGAGTCTAGGCAGGCTGAGG + Intergenic
1017993907 6:159514196-159514218 TGCACAGACCAGCCAGGCAGGGG + Intergenic
1018730403 6:166645951-166645973 TGCAGACTCCAGGCCCGCTTTGG - Intronic
1019432555 7:1005923-1005945 TGCAGGGACCAGGGAGGCAGCGG + Intronic
1019451188 7:1099266-1099288 TGCAGAGACCAGCGAGGCTCCGG - Intronic
1019734059 7:2641777-2641799 TGCAGAGGCCAGGCTGGCCACGG + Intronic
1020457549 7:8391246-8391268 TGCTGGGACCAGCCAGGCTGGGG + Intergenic
1021555064 7:21910784-21910806 TCCAGAATCCAGGCAGGCCTGGG + Intronic
1022663607 7:32387934-32387956 TGTAGAGGCCAGGAAAGCTTTGG - Intergenic
1022885781 7:34642281-34642303 TGCAGATAGCAGGTAGGCTGGGG + Intergenic
1022887437 7:34661203-34661225 TATAGAGACCAGGCAGGGTAGGG - Intronic
1023177689 7:37449067-37449089 GGCAGGGACCAGGCAGGGTGCGG - Exonic
1023833813 7:44056999-44057021 TGCAGAAACTAAGCAGGCATGGG - Intronic
1027046556 7:74994996-74995018 TGCAGATTCCAGGGAGGCCTTGG + Intronic
1028485311 7:91350950-91350972 TCCCAAGACCAGGAAGGCTTGGG + Intergenic
1029375943 7:100177082-100177104 TGCAGAGACCCGGCAGGTGCTGG - Exonic
1029386428 7:100246606-100246628 TGCAGATTCCAGGGAGGCCTTGG - Intronic
1029450997 7:100641749-100641771 TGCAGGGAGGAGGCAGGCGTGGG - Exonic
1029709011 7:102289465-102289487 TGCAGAGGACAGGCAGGAGTTGG + Intronic
1030536372 7:110772067-110772089 TCAAGAGACCAGGCAGCTTTTGG - Intronic
1030685136 7:112478632-112478654 TGCAGAATTCAGGCAGGCCTAGG - Intronic
1032169464 7:129572517-129572539 TGCAGAGCAAAGGCAGCCTTTGG + Intergenic
1034743807 7:153503956-153503978 TGCAGAGACCTGCCAGGAGTGGG - Intergenic
1035620234 8:1031065-1031087 CGCAGACGCCAGGCAGGCTCTGG - Intergenic
1035671654 8:1422727-1422749 TGCTGAGACCAGCCAGGATTGGG + Intergenic
1037366662 8:18129398-18129420 TGCAGTGACCATGCAGGCTTAGG + Intergenic
1037650565 8:20834440-20834462 TGCATAGCCCTTGCAGGCTTTGG + Intergenic
1037777055 8:21842451-21842473 TCAAGAGAGCAGGCAGGGTTAGG - Intergenic
1038424912 8:27458776-27458798 TGCATGGACCAGGCTGGCTTAGG - Exonic
1040896467 8:52373806-52373828 TGCAGAGACAGAGCAGGCATAGG - Intronic
1041953374 8:63529587-63529609 TGCAGAGACCATGATGGCTGAGG + Intergenic
1042068705 8:64906801-64906823 TGCATGGACCAGGGAGGCTGGGG + Intergenic
1045036367 8:98179419-98179441 TGCAGCGACAGGGCAGGGTTTGG + Intergenic
1048500139 8:134968040-134968062 TTCAGAGACCATACAAGCTTGGG + Intergenic
1048866367 8:138764513-138764535 TGCAGAGCCCAGAGAGGGTTGGG - Intronic
1049606277 8:143530591-143530613 TGCACAGGCCGGCCAGGCTTAGG + Intronic
1049641721 8:143718969-143718991 TGCAGAGAGGAGGCAGGCTGAGG - Intronic
1049796014 8:144497571-144497593 TGAAGAGACCAGGCAAGATCTGG - Intronic
1051636392 9:19184408-19184430 TGCCGAGAACAGGAAGGCCTGGG - Intergenic
1053111830 9:35467598-35467620 TGCAGAGACTGGGTAGGATTTGG - Intergenic
1053527021 9:38840542-38840564 TCCAGGGAACAGGCAGGCTGAGG + Intergenic
1054199247 9:62064973-62064995 TCCAGGGAACAGGCAGGCTGAGG + Intergenic
1054639109 9:67523384-67523406 TCCAGGGAACAGGCAGGCTGAGG - Intergenic
1056589079 9:87951264-87951286 GGCAGAGTCCAAGCAGGCTGTGG + Intergenic
1057336809 9:94162066-94162088 TGGAGAGAACATGCAGCCTTTGG - Intergenic
1058103118 9:100938276-100938298 TGCAGAGTTCAGGCAGGGGTGGG + Intergenic
1061427290 9:130507238-130507260 TGCAGGCACTAGGCAGGCTGAGG + Intergenic
1061618417 9:131794987-131795009 GGCAGAGACCAGCCAGACTCAGG + Intergenic
1061952186 9:133942819-133942841 TGCAGAGACCACCCTGGGTTGGG - Intronic
1062116785 9:134813885-134813907 GGCAGACAGCAGGCAGGATTTGG + Intronic
1062429780 9:136521799-136521821 TGCAGGGGCCAGGCCAGCTTGGG + Intronic
1062492443 9:136812852-136812874 GGCAGAAGCCAGGAAGGCTTTGG - Intronic
1062574265 9:137199264-137199286 TGCAGAGGCCTGGCAGGGTGCGG + Exonic
1062629142 9:137455861-137455883 TGCTGAGACCAGGCAGCCTGAGG + Intronic
1203739311 Un_GL000216v2:164803-164825 GGCAGAGACCAGGCAAGAGTTGG - Intergenic
1203740589 Un_GL000216v2:174067-174089 GGCAGAGACCAGGCAAGAGTTGG + Intergenic
1203492292 Un_GL000224v1:118821-118843 TGCAGGGACAAGGCAGGCGTTGG + Intergenic
1203504915 Un_KI270741v1:60693-60715 TGCAGGGACAAGGCAGGCGTTGG + Intergenic
1186308931 X:8296440-8296462 GGCAAAGACCAGGGAGACTTTGG - Intergenic
1186418565 X:9405141-9405163 TTCAGAGACCAGACAAGATTGGG - Intergenic
1186418907 X:9408047-9408069 TTCAGAGACCAGACAAGATTGGG - Intergenic
1186419019 X:9408979-9409001 TTCAGAGACCAGACAAGATTGGG - Intergenic
1186419127 X:9409910-9409932 TTCAGAGACCAGACAAGATTGGG - Intergenic
1186419357 X:9411886-9411908 TTCAGAGACCAGACAAGATTGGG - Intergenic
1186596283 X:10985091-10985113 TCCAGAGACCAGGCAGACCTTGG - Intergenic
1187388856 X:18872809-18872831 GGCAGAGCCCAGTCAGGCTCCGG + Intergenic
1187877654 X:23817338-23817360 TGGTGAGGCCAGGCAGGCTGGGG - Intergenic
1188842175 X:35029764-35029786 TGCAGAGATCAGGGAGACTGAGG + Intergenic
1189097761 X:38158125-38158147 GGCAGTGGCCAGGCTGGCTTTGG + Intronic
1189125003 X:38436776-38436798 ATCAGAGACCAGGGATGCTTGGG + Intronic
1190542370 X:51490706-51490728 TGCAGAAACCAGGTAGGATGAGG + Exonic
1193246583 X:79237161-79237183 TGCAGAGAGCAGGGAGGCCCTGG + Intergenic
1196816543 X:119669529-119669551 TGCAGAGGCCTGGCAGGCAGTGG + Intronic
1197867687 X:131036274-131036296 TGAAGAGACAAGGCAGCCCTTGG + Intergenic
1199760624 X:150901655-150901677 TGTGTAGACGAGGCAGGCTTGGG - Intergenic
1201176560 Y:11313120-11313142 GGCAGAGACCAGGCAAGAATTGG + Intergenic